HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via ISI Web of Science (112) Citing Articles via Google Scholar Google Scholar Articles by Gamba, G. Search for Related Content PubMed PubMed Citation Articles by Gamba, G.

Molecular Physiology and Pathophysiology of Electroneutral Cation-Chloride Cotransporters

Molecular Physiology Unit, Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán and Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, Mexico City, Mexico

ABSTRACT

I. INTRODUCTION

II. MOLECULAR BIOLOGY

A. Na+-Coupled Chloride Cotransporters

1. The thiazide-sensitive Na+–Cl– cotransporter

2. The apical bumetanide-sensitive Na+-K+-2Cl– cotransporter

3. The basolateral bumetanide-sensitive Na+-K+-2Cl– cotransporter

B. K+-Coupled Chloride Cotransporters

1. The K+-Cl– cotransporter KCC1

2. The K+-Cl– cotransporter KCC2

3. The K+-Cl– cotransporter KCC3

4. The K+-Cl– cotransporter KCC4

C. Orphan Members

D. Genes and Promoter Characteristics

1. Na+-coupled chloride cotransporters

2. The K+-coupled chloride cotransporters

E. Phylogenetic and Sequence Comparison

III. FUNCTIONAL PROPERTIES

A. Thiazide-Sensitive Na+-Cl– Cotransporter

B. Apical Bumetanide-Sensitive Na+-K+-2Cl– Cotransporter

C. Basolateral Bumetanide-Sensitive Na+-K+-2Cl– Cotransporter

D. K+-Cl– Cotransporter 1

E. K+-Cl– Cotransporter 2

F. K+-Cl– Cotransporter 3

G. K+-Cl– Cotransporter 4

H. Orphan Members

IV. STRUCTURE-FUNCTION RELATIONSHIPS

A. Na+-Coupled Chloride Cotransporters

1. The Na+-coupled chloride cotransporter forms homodimers

2. Affinity modifier domains or residues in the Na+-K+-2Cl– cotransporter

3. Cysteine scanning mutagenesis in Na+-K+-2Cl– cotransporter

4. Regulatory motifs in BSC2/NKCC1 amino-terminal domain

5. The thiazide-sensitive Na+-Cl– cotransporter

B. K+-Coupled Chloride Cotransporters

V. PHYSIOLOGICAL ROLES

A. Thiazide-Sensitive Na+-Cl– Cotransporter

B. Apical Bumetanide-Sensitive Na+-K+-2Cl– Cotransporter

1. Molecular physiology of salt reabsorption by TALH

2. Regulation of the Na+-K+-2Cl– cotransporter

C. Basolateral Bumetanide-Sensitive Na+-K+-2Cl– Cotransporter

D. K+-Cl– Cotransporter 1

E. K+-Cl– Cotransporter 2

F. K+-Cl– Cotransporter 3

G. K+-Cl– Cotransporter 4

VI. PATHOPHYSIOLOGICAL ROLES

A. Gitelman's Disease

B. Bartter's Disease

C. Anderman's Disease

D. Gordon's Disease

E. Potential Role in Polygenic Diseases

1. Arterial hypertension

2. Epilepsy

3. Cancer

4. Osteoporosis

VII. CONCLUSIONS AND PERSPECTIVE

ACKNOWLEDGMENTS

REFERENCES

	ABSTRACT

Top Next References

	I. INTRODUCTION

Top Previous Next References

 
In absorptive and secretory epithelia, transcellular ion transport depends on specific plasma membrane proteins for mediating ion entry into and exit from cells. In basolateral membrane of almost all epithelia (with exception of choroidal plexus), sodium exit and potassium entrance occur through Na⁺–K⁺–ATPase, generating electrochemical gradients that constitute a driving force for Na⁺ influx and K⁺ efflux. Transport of these ions following their gradients can be accomplished by specific ion channels, allowing membrane passage of ions alone or by transporters in which Na⁺ or K⁺ transport is accompanied by other ions or solutes by means of several different solute transporters. These membrane proteins are known as secondary transporters because ion or molecule translocation is not dependent on ATP hydrolysis but rather on gradients generated by primary transporters. A secondary transport mechanism that is very active in trancellular ion transport in epithelial cells is one in which cations (Na⁺ or K⁺) are coupled with chloride, with a stoichiometry of 1:1; therefore, ion translocation produces no change in transmembrane potential. For this reason, these transporters are known as electroneutral cation-Cl^– coupled cotransporters. In addition to being heavily implicated in ion absorptive and secretory mechanisms, electroneutral cation-Cl^– coupled cotransporters play a key role in maintenance and regulation of cell volume in both epithelial and nonepithelial cells. Because Na⁺ influx and K⁺ efflux by electroneutral cotransporters are rapidly corrected by Na⁺–K⁺–ATPase, the net effect of its activity is Cl^– movement inside or outside cells. This is known to be accompanied by changes in cell volume. Finally, a variety of new physiological roles for electroneutral cotransporters are emerging. One example is regulation of intraneuronal Cl^– concentration, thus modulation of neurotransmission (77).

Four groups of electroneutral cotransporter systems have been functionally identified based on cation(s) coupled with chloride, stoichiometry of transport process, and sensitivity to inhibitors. These systems include 1) the benzothiadiazine (or thiazide)-sensitive Na⁺–Cl^– cotransporter, 2 and 3) the sulfamoylbenzoic (or bumetanide)-sensitive Na⁺–K⁺–2Cl^– and Na⁺–Cl^– cotransporters, and 4) the dihydroindenyloxy-alkanoic acid (DIOA)-sensitive K⁺–Cl^– cotransporter. There is some overlap in sensitivity to inhibitors in the last two groups because Na⁺–K⁺–2Cl^– and K⁺–Cl^– cotransporters can be inhibited by high concentration of DIOA or loop diuretics, respectively; however, affinity for inhibitor and the cation coupled with chloride clearly differentiate between both groups of transporters. Physiological evidence for these transport mechanisms became available at the beginning of the 1980s (341) (95, 138, 237), and a remarkable amount of information was generated in the following years by characterizing these transport systems in many different cells and experimental conditions.

Major advances have been made in the past decade in molecular identification and characterization of solute carriers. To date, Human Genome Organization (HUGO) Nomenclature Committee Database recognizes 43 solute carries (SLC) families, which include a total of 298 transporter genes encoding for uniporters (passive transporters), cotransporters (coupled transporters), antiporters (exchangers), vesicular transporters, and mitochondrial transporters (175). This amount of solute carrier genes represents ~1% of the total pool of genes that have been calculated to compose human genome. One of the families that was identified at the molecular level during the last decade contains all genes encoding for electroneutral cation-Cl^– coupled cotransporters and is known as the SLC12 family (173). With molecular identification of the first members, several tools became available to isolate remaining members and to study these proteins from molecular organization of their genes, to their role in monogenic and polygenic disease. To date, seven clearly characterized genes and two orphan members compose this family. It is the major goal of this review to present comprehensive information of knowledge generated in SLC12 family as a consequence of cloning cDNAs encoding its different members. Information is divided into five major subjects that include 1) molecular biology of each gene, 2) functional properties of the recombinant proteins, 3) insights into structure-function analysis, 4) physiological role of each cotransporter, and 5) involvement of electroneutral cotransporters in pathophysiology of monogenic and polygenic disease.

	II. MOLECULAR BIOLOGY

Top Previous Next References

 
After the discovery of electrically silent cotransport mechanisms in mammalian cells and tissues 25 years ago (138, 340), several laboratories undertook unrewarded attempts to identify the proteins responsible for such a transport system (94, 107, 121, 197, 251, 406). However, the major breakthrough in this field came in the early 1990s from two different laboratories that were able to identify the genes responsible for Na⁺–Cl^– (136, 137) and Na⁺–K⁺–2Cl^– cotransporters (136, 311, 440). As eloquently predicted by Homer Smith in his remarkably elegant book about fish and philosophy (378), cDNA encoding these proteins were identified first from fish sources, because tissue from these animals proved to be an ideal source of proteins and mRNA, due to the robust expression of these transport systems. Thereafter, homology-based approaches were used to identify corresponding orthologs from mammalian tissues.

A. Na⁺-Coupled Chloride Cotransporters

1. The thiazide-sensitive Na⁺–Cl^– cotransporter

The first electroneutral cotransporter protein identified at the molecular level was the thiazide-sensitive Na⁺–Cl^– cotransporter from Pseudopleuronectes americanus (winter flounder) urinary bladder (137). Original evidence that suggested the existence of a Na⁺–Cl^– cotransporter was obtained by Renfro (340), who observed that sodium and chloride were actively transported by the flounder's urinary bladder in which Renfro thought there was an electrically silent mechanism. Subsequently, he was able to demonstrate in isolated perfused urinary bladder a clear interdependence of active Na⁺ and Cl^– transport that was independent of transepithelial voltage (341). A few years later, pharmacological properties of this Na⁺–Cl^– cotransport system were defined by Stokes et al. in two studies (389, 388) in which the investigators observed in bladder preparations that mucosal-to-serosal Na⁺ and Cl^– transport were completely inhibited in a dose-dependent fashion by thiazide-type diuretics hydrochlorothiazide and metolazone. These drugs had no effect when applied to the serosal side of the bladder. It was also shown that the Na⁺–Cl^– cotransporter was not inhibited by barium, acetazolamide, furosemide, amiloride, DIDS, ouabain, and diphenolamine carboxylate (DPC). In fact, in the absence of a mammalian tissue to test the potency of thiazides, winter flounder urinary bladder was suggested as a model to assess effectiveness of this class of diuretics (244). In addition to these observations, another similarity observed between mammalian distal convoluted tubule (DCT) and winter flounder urinary bladder was that in both epithelia, inhibition of Na⁺–Cl^– cotransporter with thiazides resulted in increased calcium absorption (63, 452). In the marine teleost, urinary bladder is functionally and anatomically an extension of mesonephric kidney, that is, the embryologically derived form of mesoderm, representing a kind of distal tubule located outside the kidney (227). All this information was taken by Hebert and co-workers (137) to identify a clone from a winter flounder urinary bladder size-fractionated, poly(A)⁺–RNA directional cDNA library constructed into pSPORT1, which encodes a thiazide-sensitive Na⁺–Cl^– cotransporter using a functional expression strategy in Xenopus laevis oocytes. The cloning strategy was based on the ability of mRNA isolated from winter flounder urinary bladder to give rise to thiazide-(metolazone)-sensitive Cl^–-dependent ²²Na⁺ uptake when injected into X. laevis oocytes. Consistent with previous observations, it was shown that furosemide, acetazolamide, ouabain, amiloride, and DIDS had no effect on cotransporter activity. The 3.7-kb cDNA clone was named flTSC for flounder thiazide-sensitive cotransporter. As shown in Table 1, nucleotide sequence predicted an open reading frame (ORF) of 3,069 bp encoding a protein of 1,023 amino acid residues with a core molecular mass of 112 kDa. Hydropathy analysis following the algorithm proposed by Kyte and Doolittle (226) revealed the basic structure of the Na⁺-coupled chloride cotransporters shown in Figure 1, featuring a central hydrophobic domain containing 12 -helices compatible with putative transmembrane-spanning segments that is flanked by a short hydrophilic amino-terminal domain and a long predominantly hydrophilic carboxy-terminal domain. The latter two domains are presumably located within the cell. There is a long hydrophilic loop connecting transmembrane segments 7 and 8, exhibiting three putative N-glycosylation sites that are located toward the putative extracellular side of the protein. Tissue distribution analysis by Northern blot in winter flounder revealed expression of a 3.7-kb transcript in urinary bladder and a shorter 3.0-kb message in several tissues including gonads, intestine, eye, brain, skeletal muscle, and heart (137). It was also observed that this shorter transcript of 3.0 kb is the result of an alternative splicing mechanism, in which the first 229 residues encoding the amino-terminal domain and the first three putative transmembrane segments are lost. The functional consequence of such splicing has not been resolved (276).

View larger version (29K): [in this window] [in a new window]   FIG. 1. Proposed topologies for members of the electroneutral cation-chloride cotransporter family. SLC12A1–3 in black is the topology proposed for Na+-coupled chloride cotransporters BSC1/NKCC2, BSC2/NKCC1, and TSC. SLC12A4–7 in blue depict the topology proposed for K+-coupled chloride cotransporters KCC1, KCC2, KCC3, and KCC4. SLC12A8/CCC9 in red corresponds to topology for the orphan member CCC9. This is the most distant member, because there are only 11 predicted transmembrane segments and the carboxy-terminal domain is predicted to be located outside the cell. SLC12A9/CIP in green is the topology proposed for an orphan member known as CIP or cotransporter interacting protein and resembles the topology for KCCs cotransporters.

Rabbit and human TSC are longer than rat and mouse orthologs due to presence of 17–26 amino acid residues in the carboxy-terminal domain that are not present in rat and mouse TSC (Fig. 2). These extra residues were shown to be encoded by a separate exon (exon 20) in humans that is not present in mouse or rat. However, two distinct Homo sapien TSC mRNA sequences have been deposited into the genome database (www.ncbi.nlm.nih.gov). The sequence from Mastroianni et al. (265) (X91220) exhibits 1,021 residues, including 17 extra amino acids not present in rat or mouse TSC sequence. In contrast, one sequence deposited by Simon et al. (377) (NM_000339) exhibits 1,030 residues with 26 extra residues not present in rat or mouse (Table 1). As shown in Figure 2, rabbit TSC sequence is similar to the sequence reported by Simon et al., because the 26 extra residues from exon 20 are present in this rodent. BLAST search of genomic databases with 78 bp encompassing the DNA sequence encoding the 26-amino acid fragment revealed that this sequence aligns perfectly with a fragment of the RP11–325K4 clone containing full sequence of human chromosome 16, suggesting that exon 20 indeed encodes 26 residues, instead of 17. It is noteworthy that in humans there is a putative protein kinase A (PKA) site (RPS) within the extra fragment that is not present in rabbit, mouse, or rat TSC.

View larger version (16K): [in this window] [in a new window]   FIG. 2. Sequence alignment of the carboxy-terminal domain fragment in TSC from several species, from residues 789–826 of human TSC. Human 1 and human 2 correspond to sequences deposited in Genebank by Simon et al. (Genebank accession no. NM_000339) and Mastroianni et al. (Genebank accession no. X91220), respectively. The box in human 1 sequence highlights a putative protein kinase A phosphorylation site.

Two genes encoding bumetanide-sensitive Na⁺-K⁺-2Cl^– cotransporters were identified as part of the SLC12 family. These genes are known as SLC12A1 and SLC12A2 and encode for the apical and basolateral isoforms, respectively. The SLC12A1 gene is a renal-specific Na⁺-K⁺-2Cl^– cotransporter isoform exclusively expressed in the apical membrane of thick ascending limb of Henle (TALH). The cDNA encoding this cotransporter was simultaneously identified from mammalian kidney in 1994 by two groups. Payne and Forbush (311) screened rabbit cortical and medullary cDNA libraries inserted in ZAP using a ³²P-DNA random-primed probe constructed from cDNA encoding the T84 human colonic basolateral Na⁺-K⁺-2Cl^– cotransporter. As shown in Table 1, a full-length clone of 4,750 bp was identified, with an ORF of 3,297 bp encoding a protein of 1,099 amino acid residues. Tissue distribution analysis by Northern blot revealed the presence of transcripts only in total RNA extracted from kidney. No functional expression was presented, but based on high homology with basolateral Na⁺-K⁺-2Cl^– cotransporter, it was proposed that the isolated clone encoded the apical isoform of this cotransporter. Because in 1994 this group first cloned the basolateral isoform (see later) that was named NKCC1, their clone encoding the apical, renal-specific isoform of the Na⁺-K⁺-2Cl^– cotransporter was denominated NKCC2. Simultaneously, Gamba et al. (136) isolated a 4,546-bp clone from a size-fractionated cDNA library constructed from poly(A)⁺ RNA extracted from inner stripe of outer medulla of rat kidney. The library was screened using a random-primed ³²P-DNA probe derived from the coding region of flTSC transporter. The 3,285-bp ORF encodes a 1,095-residue protein exhibiting 93% identity with rabbit NKCC2. Tissue distribution by Northern blot analysis also showed that transcripts were present only in total RNA from kidney; all other tissues were negative. Functional expression analysis in X. laevis oocytes demonstrated that the isolated clone induced a significant increase in ⁸⁶Rb⁺ uptake that was Cl^– dependent, Na⁺ dependent, and bumetanide sensitive, indicating that it encodes for a Na⁺-K⁺-2Cl^– cotransporter. Because this investigative group previously denominated the thiazide-sensitive Na⁺-Cl^– cotransporter cDNA clone from flounder urinary bladder as flTSC (137), the identified cDNA clone from renal outer medulla was denominated rBSC1 for rat bumetanide-sensitive Na⁺-K⁺-2Cl^– cotransporter 1; thus the apical Na⁺-K⁺-2Cl^– cotransporter encoded by SLC12A1 gene is indistinctly known as BSC1 or NKCC2. Hereafter I will refer to this cotransporter as BSC1/NKCC2. After initial cloning of BSC1/NKCC2 from rat and rabbit kidney, the same cotransporter was identified at the molecular level from mouse and human kidney (Table 1). Igarashi et al. (187) identified a 4,655-bp clone from a mouse renal outer medulla library containing a 3,285 ORF that encodes a 1,095-amino acid transporter that is 93 and 97% identical to rabbit and rat BSC1/NKCC2, respectively. By Northern blot and in situ hybridization analysis, they showed that in mouse, BSC1/NKCC2 is also expressed exclusively in kidney, including developing kidney from the hybridization signal in mouse embryo detected only in metanephros. Finally, Simon et al. (375) reported the primary structure of human BSC1/NKCC2 as part of their study of SLC12A1 gene involvement in Bartter's disease. Human BSC1/NKCC2 is 95% identical to rabbit and 93% to rat or mouse BSC1/NKCC2. As shown in Figure 1, the proposed topology of BSC1/NKCC2 is very similar to that of TSC or BSC2/NKCC1. A central hydrophobic domain of ~475 residues containing 12 putative membrane-spanning segments is flanked by two predominantly hydrophilic domains: a short amino-terminal domain of ~165 amino acids and a long carboxy-terminal domain of ~450 residues. Both domains are presumably located within the cell and contain several putative PKA and protein kinase C (PKC) phosphorylation sites. Central hydrophobic domain exhibits a long hydrophilic loop located between transmembrane segments 7 and 8 that contains two putative N-glycosylation sites.

Molecular diversity in electroneutral cotransporter family is increased due to existence of alternative splicing isoforms or variants. At least six isoforms of BSC1/NKCC2 are expressed in mouse kidney due to combination of two alternatively splicing mechanisms (Fig. 3) (135, 290). The first was described by Payne and Forbush during cloning of rabbit Na⁺-K⁺-2Cl^– cotransporter (311) and was also observed to be present in mouse (187), rat (447), and human (375) kidney. This splicing mechanism is due to presence of three mutually exclusive cassette exons of 96 bp designated A, B, and F, which encode for 32 amino acid residues corresponding to the second half of the putative transmembrane domain TM2 and the contiguous intracellular loop between TM2 and TM3 (Fig. 3). This splicing mechanism produces three BSC1/NKCC2 proteins that are identical, with the exception of the 32 amino acids encoded by A, B, or F cassettes. Existence of an isoform containing exons A and F together was suggested by Yang et al. (447) following amplification of a DNA band for such an isoform by PCR; nonetheless, its real existence as a protein was not addressed. BSC1/NKCC2 orthologs for isoforms A and F were also identified at the molecular level by Gagnon et al. (134) from Squalus acanthias (shark) kidney. Interestingly, no isoform B is expressed in shark kidney, which lacks a well-developed juxtaglomerular complex. Because there are data to support that B isoform could be the Na⁺-K⁺-2Cl^– sensing isoform in macula densa cells (see sect. VB), this observation suggests that B exon arose later in the evolutionary chain, when complete tubuloglomerular feedback mechanisms were developed. Interestingly, the AF isoform was also observed by Gagnon et al. (134) in shark kidney, together with other spliced variants lacking transmembrane segment 8; however, all these variants were not functional when expressed in HEK-293 cells or in X. laevis oocytes.

View larger version (17K): [in this window] [in a new window]   FIG. 3. Splice variants of the mouse apical, renal specific Na+-K+-2Cl– cotransporter BSC1/NKCC2. The central hydrophobic domain containing 12 putative transmembrane segments is flanked by predominantly hydrophilic amino- and carboxy-terminal domains. Two glycosylation sites are depicted in the extracellular loop between membrane segments 7 and 8. The region of transmembrane domain 2 and the interconnecting segment between transmembrane domains 2 and 3 that are highlighted in green depict the mutually exclusive cassette exons A, B, or F. The long isoform BSC1-L contains 329 amino acid residues in the carboxy-terminal domain (highlighted in red) that are not present in the shorter isoform BSC1-S, which contains 55 unique residues at the end of the carboxy-terminal domain (highlighted in blue). Arrows show putative protein kinase A phosphorylation sites unique to each isoform.

3. The basolateral bumetanide-sensitive Na⁺-K⁺-2Cl^– cotransporter

SLC12A2 gene encodes the Na⁺-K⁺-2Cl^– cotransporter that is ubiquitously expressed. This cotransporter is present in both epithelial and nonepithelial cells. In epithelial cells, its expression is confined to basolateral membrane, some examples of which are gills, trachea, intestine, and renal collecting duct. The sole exception is choroid plexus, in which this cotransporter is expressed in apical membrane (326). In 1994, the same two independent research teams who cloned BSC1/NKCC2 also identified cDNA encoding the basolateral cotransporter. Xu et al. (440) using monoclonal antibodies J3 and J7 that recognize epitopes in the carboxy-terminal half of the cotransporter (256) were able to isolate from a shark rectal gland cDNA library a single 5,260-bp cDNA clone that encoded a protein of 1,191 amino acid residues. When this clone was transfected into HEK-293 cells, a robust bumetanide-sensitive Na⁺-K⁺-2Cl^– cotransporter mechanism was induced, exhibiting functional properties similar to those previously shown as present in shark rectal gland (127). As shown in Table 1, full-length cDNA clone was denominated NKCC1. Tissue distribution analysis by Northern blot revealed presence of NKCC1 transcripts in all tissues. Also in 1994, this team was also able to identify the mammalian ortholog from a human colonic (T84 epithelial cell line) cDNA library using a probe constructed from shark NKCC1 cDNA. ORF of 3,036 bp predicted that human NKCC1 is a 1,212-amino acid residue cotransporter with molecular mass of 132 kDa, which by Northern blot analysis was also shown to be expressed in most tissues. Simultaneously, a cDNA encoding the basolateral Na⁺-K⁺-2Cl^– cotransporter was identified from a mouse inner medullary collecting duct cell line (mIMCD-3) cDNA library by Delpire et al. (80), using degenerative primers that were designed over highly homologous regions of putative transmembrane domains 1 and 10 of TSC and BSC1 (136, 137). Because these authors previously denominated thiazide-sensitive Na⁺-Cl^– cotransporter as TSC (137) and apical renal-specific bumetanide-sensitive Na⁺-K⁺-2Cl^– cotransporter BSC1 (136), basolateral isoform was denominated BSC2. Hereafter I will refer to this cotransporter as BSC2/NKCC1.

As shown in Figure 1, the proposed topology of BSC2/NKCC1 is similar to that of TSC or BSC1/NKCC2. The central hydrophobic domain exhibits a long hydrophilic loop located between transmembrane segments 7 and 8 that contains two putative N-glycosylation sites, both of which are conserved in BSC1/NKCC2, but only one of which is present in TSC. BSC2/NKCC1 is the only member of the family to date for which proposed topology is supported by experimental data. Gerelsaikhan and Turner (140) studied transmembrane topology of NKCC1 using an in vitro translation system designed to test membrane-insertion properties of putative membrane-spanning helices, by fusing each with a carboxy terminal reported sequence containing multiple N-linked glycosylation sites. With this strategy, they observed that NKCC1 is indeed composed of 12 membrane-spanning segments. The first eight segments exhibit the classical ~20 residue length helices, while segments 9 and 10, as well as segments 11 and 12 together are ~36 residues in length, suggesting that these transmembrane segments form a hairpin-like structure in the membrane or take up either a nonhelical or a partial helical structure. Presence of asparagine and proline residues in the middle between segments 9 and 10, and segments 11 and 12 are in accord with the possibility that hairpin helices are present (282).

As shown in Table 1, basolateral Na⁺-K⁺-2Cl^– cotransporter BSC2/NKCC1 has been identified at the molecular level from other three species including rat (284), Bos taurus (bovine) (448), and Anguilla anguilla (eel) (69). The case of eel is interesting because Cutler and Cramb (69) identified two different genes encoding highly homologous NKCC1 isoforms that were denominated NKCC1a and NKCC1b. Degree of identity at amino acid level between both cotransporters is ~80%. The majority of the divergence is located in the first 80–90 residues of the amino-terminal domain in which degree of identity is not >35%; however, the remainder of the sequence exhibits an identity of 85%. NKCC1a of ~13 kb was present in all tissues, whereas NKCC1b of 6 kb was observed only in brain RNA. The authors proposed that existence of two NKCC1 genes in eel fits with the paradigm that a certain percentage of the teleost genome underwent ancient duplication. Functional differences between both cotransporters have not been explored.

Molecular diversity in BSC2 is also increased by existence of one alternatively spliced isoform. As part of their cloning and characterization of mouse SLC12A2 gene, Randall et al. (332) intentionally searched for alternative spliced isoforms by PCR-amplifying segments containing two to three exons. A spliced variant was detected from mouse brain total RNA; it lacked the 48 bp that correspond to entire exon 21. Thus 16 residues within the carboxy terminal are not present. Existence of spliced transcript was confirmed by RNase protection assay. Analysis of distribution within brain showed that transcript lacking exon 21 is present in all areas examined except in choroid plexus, in which the only isoform containing exon 21 is expressed. This spliced variant, however, was also observed in human ocular-trabecular meshwork cells; in addition, with the use of a kinetic PCR strategy it was observed that exon 21-lacking isoform is expressed in several human tissues, with an up to 68-fold variation in isoforms ratio among 14 tested tissues. Brain was the only tissue in which the isoform lacking exon 21 was significantly more abundant than the longer one (418). Spliced variant performs as an Na⁺-K⁺-2Cl^– cotransporter (418), but its physiological significance is not yet known. However, it is important to note that the absence of the exon 21 sequence removes the sole putative PKA site present in the entire BSC2 sequence.

B. K⁺-Coupled Chloride Cotransporters

The K⁺-Cl^– cotransport mechanism was first described in low-potassium sheep red blood cells as a swelling- and N-ethylmaleimide (NEM)-activated K⁺ efflux pathway (95, 237). Cotransport of K⁺ and Cl^– is interdependent, with a 1:1 stoichiometry and low-affinity constants for both ions (for excellent reviews, see Refs. 62, 235). Although red blood cells have remained as the primary model tissue for this class of ion transport, functional and physiological evidence for existence of a similar K⁺-Cl^– cotransporter was soon reported in several cells and tissues including neurons (346), vascular smooth muscle (4), endothelium (317), epithelia (12, 155), heart (445), and skeletal muscle (430), suggesting that K⁺-Cl^– cotransport is implicated not only in regulatory volume decrease, but also in transepithelial salt absorption (12), renal K⁺ secretion (108), myocardial K⁺ loss during ischemia (445), and regulation of neuronal Cl^– concentration (346). Molecular identification of genes encoding K⁺-Cl^– cotransporters was possible due to their homology with Na⁺-coupled Cl^– cotransporters. Four genes encoding K⁺-Cl^– cotransporters were identified as part of the SLC12 family; these genes are known as SLC12A4, SLC12A5, SLC12A6, and SLC12A7 and encode the isoforms known as KCC1, KCC2, KCC3, and KCC4, respectively.

1. The K⁺-Cl^– cotransporter KCC1

Identification of four K⁺-Cl^– cotransporter genes was possible due to the so-called in silico cloning strategies (291) that were based on identification of sequences in Genebank, particularly the expressed sequence tag databases (dbEST), which were initiated in 1992 and that underwent dramatic enlargement throughout the 1990s. Molecular identification of human KCC1 was based on finding several human dbEST that were <50% identical to BSC1/NKCC2, BSC2/NKCC1, or TSC, indicating that EST sequences belonged to an unidentified member of the family. Therefore, probes derived from dbEST were used by Gillen et al. (142) to isolate full-length clones from human, rat, and rabbit kidneys that encode a membrane protein of 1,085 amino acid residues (see Table 2) that is expressed in all tested tissues as a predominant 3.8-kb transcript. Stable HEK-293 cells transfected with rabbit KCC1 cDNA exhibited ⁸⁶Rb⁺ uptake and efflux mechanisms compatible with known characteristics of the red blood cell K⁺-Cl^– cotransporter, i.e., ⁸⁶Rb⁺ transport induced by rabbit KCC1 was Na⁺ independent, Cl^– dependent, furosemide sensitive, and activated by NEM or cell swelling.

As shown in Table 2, after initial cloning of KCC1 cDNA by Gillen et al. (142), KCC1 orthologs have been cloned from other species. Pellegrino et al. (316) using a homology PCR-based approach isolated cDNA clones encoding KCC1 from human erythroleukemia cell line K256 and also from mouse erythroleukemia cell line MEL. Degree of identity among human, rat, rabbit, and mouse KCC1 is ~96%. Interestingly, KCC1 was not present in human or mouse reticulocytes but was present during the early stages of erythroleukemia cell differentiation, suggesting that level of expression of KCC1 mRNA may play a role in early stages of erythroid maturation. Pellegrino et al. (316) also isolated two distinct mRNAs exhibiting different ends of the protein; one mRNA contained a stop codon at residue 1,012, resulting in a 73-amino acid truncated protein, and the second contained distinct sequence after residue 1,056 and resulted in a 23-amino acid truncated protein. It was suggested that both could be alternatively spliced isoforms; however, no further actions were taken to support this hypothesis. Finally, KCC1 has also been identified from Sus Scorfa (pig) and from Caenorhabditis elegans, exhibiting 94 and 42% identity, respectively, with other mammalian KCC1 orthologs. Both clones were shown in HEK-293 transfected cells to encode a K⁺-Cl^– cotransporter (180).

2. The K⁺-Cl^– cotransporter KCC2

Finding two EST from human brain exhibiting 35% identity with human BSC2/NKCC1 allowed Payne et al. (313) to amplify by PCR a 286-bp cDNA fragment from rat brain that was then used as a template to prepare a ³²P-DNA random primed probe to screen a rat brain cDNA library under low-stringency conditions. From 19 clones isolated, 7 were KCC1 and 12 corresponded to a new closely related cDNA named KCC2. The 5,566-bp full-length clone encodes a protein of 1,116 amino acid residues with predicted molecular mass of 123 kDa that is 67% identical to KCC1. As shown in Table 2, a similar cDNA was later isolated and sequenced from mouse as part of a large-scale project launched to identify all human and mouse ORFs by the Mammalian Gene Collection Program Team (http//mgc.nci.nih.gov) (391). Hydrophobicity analysis revealed a protein with 12 putative-transmembrane segments with a topology similar to KCC1 (Fig. 1) in which the glycosylated extracellular loop is located between transmembrane segments 5 and 6. Northern blot analysis revealed that a single transcript of ~5.6 kb was expressed only in poly(A)⁺ RNA from the central nervous system (CNS), indicating that KCC2 is a brain-specific gene. By PCR analysis, several rat nervous system-derived cell lines such as primary astrocytes, glioma cell line, and pheochromocytoma cell line were positive for KCC1 but negative for KCC2. In addition, in situ hybridization analysis revealed that KCC2 is present in all layers of cortex, all areas of hippocampus, and the granular layer of the cerebellum, whereas white matter was devoid of any signal, suggesting that KCC2 is expressed exclusively in neurons.

The KCC2 cotransporter has been also isolated and sequenced from other two species. Human KCC2 cDNA was isolated by Song et al. (380) using a PCR-based homology approach. As shown in Table 2, a single 5,907-bp cDNA was isolated that encodes a 1,116-residue protein that is 99% identical to rat KCC2. Differentiated NT2-N cells with retinoic acid exhibited expression of KCC2, corroborating the presence of this transcript in a neuronal-derived cell line. KCC2 cDNA has been also isolated and sequenced from mouse by means of a high-throughput sequence study designed to identify gene-coding variants within alcohol-related QTLs in a mouse model of alcohol addiction (102) and also by the Mammalian Gene Collection Program Team (http//mgc.nci.nih.gov) (391).

3. The K⁺-Cl^– cotransporter KCC3

Three groups simultaneously identified a third gene encoding a K⁺-Cl^– cotransporter (SLC12A6) from human mRNA by means of two different strategies. Hiki et al. (178) used a differential display PCR strategy in human umbilical vein endothelial cells (HUVEC) designed to identify transcripts that exhibited change in expression level after cells were treated with vascular endothelial cell growth factor (VEGF). A consistent upregulated band was sliced off and used as a probe to isolate corresponding full-length cDNA from a HUVEC library that corresponded to a putative membrane transporter with 77% identity with KCC1 and 73% with KCC2; thus isolated cDNA clone was named KCC3 and encodes a protein of 1,099 amino acid residues with a hydropathy profile identical to that of KCC1 and KCC2 (Fig. 1). It was shown in the same study in transfected HEK-293 cells that KCC3 performed as a furosemide-sensitive K⁺-Cl^– cotransporter that exhibited, however, no response to hypotonicity. The new gene was located at human chromosome 15q13 and was shown to be expressed in several tissues including brain, kidney, and liver. Simultaneously, Mount et al. (292) following the in silico strategy identified several human ESTs that were useful to isolate two new members of K⁺-Cl^– cotransporter subfamily that were named KCC3 and KCC4. These proteins exhibited ~70% identity with KCC1 and KCC2. KCC3 cDNA was isolated from a human muscle cDNA library, and Northern blot analysis revealed variable expression of two 6- to 7-kb bands in several tissues, suggesting the possibility of alternative splicing. KCC3 was also isolated by Race et al. (331) following the in silico strategy from a human placenta cDNA library. These authors, using transfected HEK-293 cells, showed that KCC3 encodes a furosemide-sensitive and an NEM-activated K⁺-Cl^– cotransporter that exhibited a slight but significant activation by hypotonicity. As shown in Table 2, full-length KCC3 cDNA isolated by Mount et al. (292) and by Race et al. (331) encodes a 1,150-amino acid residue cotransporter. The difference with the 1,099-residue protein from Hiki et al. (178) resides in length and sequence of the amino-terminal domain, due to the presence of two alternative first exons in the SLC12A6 gene with transcriptional initiation at separate promoters, which were denominated as exon 1a and exon 1b, thus generating the terminology of KCC3a and KCC3b for long and short isoforms, respectively (315). Exon 1a encodes 90 amino acids not present in the 39-residue exon 1b. mRNA encoding KCC3a is widely expressed, with abundant message by Northern blot analysis in brain, kidney, muscle, lung, and heart, while the KCC3b transcript is more abundant in kidney than in any other tissue. Interestingly, there are several potential phosphorylation sites for PKC (292) within the 51 amino acid residues present in KCC3a (exon 1a) that are thus not present in KCC3b (exon 1b) (178), suggesting that these isoforms are subjected to different posttranslational regulation. As discussed in section IIIF, KCC3a and KCC3b isoforms perform as hypotonically activated K⁺-Cl^– cotransporters when X. laevis oocytes were used as the heterologous expression system.

4. The K⁺-Cl^– cotransporter KCC4

There is a fourth gene encoding an isoform of the K⁺-Cl^– cotransporter, which was identified by Mount et al. (292) from mouse and human kidney mRNA by PCR using several ESTs to guide the design of appropriate primers. KCC4 cDNA encodes a protein of 1,083 amino acid residues with a hydropathy profile similar to that of other K⁺-Cl^– cotransporters (Fig. 1). The degree of identity with KCC1, KCC2, and KCC3 is 67, 72, and 67%, respectively. KCC4 is expressed in several tissues, with higher levels in heart and kidney and very low levels in brain. Within the CNS, the main localization of KCC4 protein is on cranial nerves (204). Functional expression in X. laevis oocytes demonstrated that KCC4 encodes a K⁺-Cl^– cotransporter that can be activated by incubation in hypotonicity or after NEM exposure (275, 292). KCC4 cDNA has also been isolated from rabbit kidney by Velázquez and Silva (414) and encodes a 1,106-amino acid protein that contains 23 extra residues not present in mouse or human orthologs. These extra residues are located within the amino-terminal domain as two separate fragments of 11 and 12 residues. No studies were done to demonstrate if this is due to alternative splicing or is a cloning artefact.

C. Orphan Members

Two orphan members of the cation-chloride cotransporter family have been described. Caron et al. (49) identified human ESTs with 25% degree of identity with KCCs, BSC1/NKCC2, BSC2/NKCC1, and TSC, suggesting that the gene encoding such a transcript could be a distant but related member of the family. A ZAP II/human heart cDNA library was screened using a random primed ³²P-DNA probe constructed from EST under low-stringency conditions until a 3,276-bp full-length transcript clone was isolated and named CIP for cotransporter interacting protein (GeneBank accession no. AF284422). A single ORF of 2,742 bp predicted a protein of 915 amino acid residues with a molecular mass of 96 kDa. As shown in Figure 1, hydropathy analysis of CIP protein revealed a topology that more closely resembles KCC cotransporters, because the long glycosylated extracellular loop is located between transmembrane segments 5 and 6. CIP amino- and carboxy-terminal domains are 44 and 370 amino acids in length, respectively. Northern blot analysis revealed wide distribution along tissues, and functional expression flux studies were performed in both HEK-293 cells and X. laevis oocytes transfected with cDNA and cRNA, respectively. Unfortunately, no increase in ²²Na⁺, ⁸⁶Rb⁺, or ³⁶Cl^– was observed under any multiple experimental approaches tested. For this reason, CIP is considered an orphan member of the family because its transport substrate is not known. However, coinjection experiments that were performed revealed that BSC2/NKCC1, but not BSC1/NKCC2 or KCC1, was significantly and reproducibly inhibited when coinjected with CIP; for this reason the new clone was denominated CIP for cotransporter interacting protein. Coimmunoprecipitation experiments suggested that a potential explanation for CIP effects upon NKCC1 involves physical interaction between both proteins. The gene SLC12A9 encoding this cotransporter was located to human chromosome 7q22.

Finally, the most recent and distant member of the family has been provisionally denoted SLC12A8 (289) (GeneBank accession no. AF345197). This is a membrane protein that is much shorter than the remainder of family members (714 amino acids), and it is ~30% identical to BSC1/NKCC2, with particular conservation of predicted transmembrane segments 1, 2, 6, and 7. Predicted topology (Fig. 1) is unique in the family because there is a short intracellular amino-terminal domain followed by 11 membrane segments, with a glycosylated carboxy-terminal tail. Transport function is not yet known because heterologous expression in X. laevis oocytes failed to detect significant activity in transport of ³⁶Cl^–, ⁸⁶Rb⁺, and ²²Na⁺ and revealed no interaction with coinjected TSC, BSC1/NKCC2, or KCC4, suggesting that this protein does not form heterodimers with other family members. There are clear orthologs within Drosophila and C. elegans genomes, and interestingly, this gene has been identified as a psoriasis-susceptibility candidate gene on chromosome 3q21 (176).

D. Genes and Promoter Characteristics

1. Na⁺-coupled chloride cotransporters

The gene encoding the renal-specific bumetanide-sensitive Na⁺-K⁺-2Cl^– cotransporter (SLC12A1) has been mapped in humans at chromosome 15 (375), in rat at chromosome 3 (423), and in mouse at chromosome 2 (330). SLC12A1 in humans encompasses 80 kb and contains 26 exons (Table 3). Intron range spans from 120 bp to 15 kb. A GT dinucleotide repeat within the gene is highly polymorphic with 42% heterozygosity in 50 unrelated subjects (375). SLC12A1 promoter region has been cloned from mouse genomic DNA (188). It was first shown in this study, using nuclear run-off assays, that BSC1/NKCC2 kidney-specific expression is due to regulation at the level of initiation of gene transcription and not at posttranscriptional regulation. Subsequently, the promoter was cloned, and transcription initiation was defined as –280 bp of the 5' start codon. It was observed, however, that in mouse SLC12A1, there is a first exon of 34 bp in length that is noncoding, followed by a first intron of 1,101 bp and a second exon containing the translation start codon. Cloned promoter is composed of 2,255 bp, and sequence analysis revealed a TATA box located at position –29 and consensus recognition sites for several transcription factors, of which the most interesting could be a binding site for HNF-1 at –211 bp. In developing mouse kidney, expression of HNF-1 precedes expression of BSC1/NKCC2 (239), and this factor has been implicated in regulation of tissue-specific expression in liver, pancreas, kidney, and intestine. One example is renal epithelium-specific expression of the Ksp-cadherin that is due to interaction with transcription factors NHF-1 and NHF-1 (21). In this regard, transfection of TALH-derived cells with pGL3B-NKCC2 construct, that contained 2,255 bp of SLC12A1 promoter region fused to a luciferase reporter gene, resulting in a 130-fold increase in luciferase activity, while transfection of NIH 3T3 cells resulted in no activity. With the use of TALH-derived cells, it was demonstrated that deletion of –2,255 to –1,529 bp produced an approximately threefold increase in luciferase activity, suggesting that this region contains negative regulatory elements. Deletion from –1,529 to –469 bp had no further effect, but deletion from –469 to –190 resulted in 76% reduction of promoter activity, suggesting that this region contains positive regulatory elements. HFN-1 binding site is located in this region. Finally, a cAMP response-element binding protein is located at nucleotide –1,111. This site could be important because it is known that Na⁺-K⁺-2Cl^– cotransporter activity in TALH is increased by vasopressin (171, 280) and that chronic administration of 1-desamino-[8-d-arginine]vasopressin (DDAVP) to Sprague-Dawley and Brattleboro rats is associated with increase in BSC1/NKCC2 abundance at protein level (209). It is not known whether this effect is at the regulation of gene transcription or by increasing protein stability. The effect of DDAVP on mRNA levels, however, has not been reported.

The gene encoding thiazide-sensitive Na⁺-Cl^– cotransporter (SLC12A3) has been mapped at chromosomes 16q13 in humans (265, 377), 19p12–14 in rats (400), and 8 in mice (308). As shown in Table 3, human SLC12A3 is 55 kb long and contains 26 exons (377). All exon-intron boundaries have the conventional 5'-GT and 3'-AT consensus splice sites. There is a polymorphic genetic marker of a GT-dinucleotide repeat within SLC12A3 gene that exhibited heterozygosity of 48% in 45 unrelated Caucasian subjects. SLC12A3 promoter region has been cloned from humans (257) and rat (400) genomic DNA. In humans, transcription initiation is confined to an area from –18 to –6 upstream of the translation start codon, and maximum promoter activity in mouse distal convoluted cell line (MDCT) (257) transfected with pCAT3 constructs was obtained with construct containing 1,019 bp of the 5'-flanking region; however, 75% of activity was observed with a promoter containing only 134 bp of the 5'-flanking region. Sequence analysis of promoter revealed the presence of a TATA element, two Sp binding sites, and potential binding sites for NF-1/CTF or NY-I/CP-I. Consistent with the general belief that TSC exhibits kidney-specific expression, the promoter region in humans displayed repressor activity in Chinese hamster ovary-derived cell line CHO-K1, which requires the presence of two Sp binding sites. Promoter activity in MDCT cells transfected with a pACT3 construct containing –1,019 to +1 of the 5'-flanking region was shown to inhibit transcription in response to acidification of the extracellular medium, but not to hypertonicity or presence of mineralocorticoid DOCA. The observation that acidosis inhibited promoter activity is consistent with a marked fall in renal cortical abundance of TSC assessed by either Western blot of renal cortical proteins (211) or by [³H]metolazone binding to plasma membranes from renal cortex (119) of rats exposed to chronic NH₄Cl loading.

With the use of luciferase reporter gene analysis in HEK-293 cells, maximal activity of rat SLC12A3 promoter was obtained with –2,093 bp of the 5'-flanking region; nonetheless, most activity was found present using a –580-bp fragment. The transcription initiation site in the rat was located 18 bases upstream of the start codon. Several putative consensus transcription factor recognition sequences were observed, including a TATA box in position –42, three SRY, five Pit-1, and two Sp1 binding sites, two glucocorticoid response elements (GRE), one cAMP response element (CRE), and an HFH-3 binding site. Rat promoter displays repressor activity in a human hepatocyte cell line (HepG2) and a rat vascular smooth muscle cell line (A10), but not in human embryonic kidney cells HEK-293 (400). In addition, transgenic rats harboring a construct containing 5'-flanking region of rat SLC12A3 promoter fused to LacZ gene displayed immunoreactivity against -galacosidase exclusively in DCT (400). One potential explanation for TSC kidney-specific expression is presence of the HFH-3 binding site in –393 bp of rat promoter. The HFH-3 transcription factor belongs to HFH/winged helix factor family, and its expression in mammalian kidney has also been shown to be restricted to the epithelium of DCT (305). Members of the HFH/winged family are known to be involved in tissue-specific gene expression and differentiation during embryonic development (228); thus HFH-3 transcription factor could be involved in defining TSC tissue-specific expression. Consistent with this view, Taniyama et al. (400) showed that overexpression of HFH-3 transcription factor stimulated activity of the 5'-FL/rTSC promoter construct in HepG2 cells, assessed by luciferase activity, and that point mutations in HFH-3 binding site on rTSC promoter were associated with marked loss of HFH-3 transcription factor effect. Stimulation, however, was only approximately threefold over activity observed in mock transfected HepG2 cells, while in HEK-293 5'-FL/TSC transfected cells, luciferase activity was 25-fold over mock-transfected cells, suggesting that other elements are probably involved in defining TSC gene expression.

2. The K⁺-coupled chloride cotransporters

Ubiquitously expressed K⁺-Cl^– cotransporter KCC1 gene SLC12A4 has been localized on chromosomes 16q22 in humans (231) and on chromosome 8 in mice (392) and encompasses a region of 23 kb in the genome and is composed of 24 exons (180). As shown in Table 3, this is the smallest gene of the electroneutral cotransporter family. Intron length ranges from 75 bp to 4.5 kb, while the exon range spans 95–242 bp. All intron-exon boundaries possess conventional 5'-GT and 3'-AT consensus splice sites. In contrast, gene encoding KCC1 in Caenorhabditis elegans is composed of 9 exons and 10 introns that encompass 3.5 kb (180). Zhou et al. (451) recently screened a human genomic BAC library and identified a 1,938-bp KCC1 promoter. A single transcription initiation site was located 121 bp before the first methionine encoding codon ATG. KCC1 promoter lacks TATA and CCAAT consensus sequences but contains one GATA-1 consensus site, two AP-2 sites, and three GC/CACC binding-related proteins that are motifs for several transcription factors including Sp-1. Transfection of different size promoters (–1938, –720, and –369) with luciferase reporter into K562 and HeLa cells demonstrated that promoter is active in both erythroid and nonerythroid cells. Finally, mutations designed to eliminate AP-2 sites reduced promoter activity by one-half, and those in which consensus sequences InR and DPE are eliminated reduced activity by >10-fold.

Neuronal-specific K⁺-Cl^– cotransporter KCC2 gene SLC12A5 has been mapped at chromosome 20q13 in humans (354, 380) and at chromosome 5 in mice (354) (Table 3). Human SLC12A5 encompasses 24 coding exons spread over ~30 kb of genomic DNA. Exons 21 and 22 encode a carboxy-terminal insertion unique to KCC2 discussed later. All intron-exon boundaries obey GT-AG (380). Mean exon size is 140 bp, ranging from 45 to 242 bp. The SLC12A5 promoter region has not been studied in detail. However, it is known that neuron-restricted expression pattern in KCC2 is at least due in part to the presence of a neuronal-restrictive silencing element (NRSE). A genomic clone containing ~7 kb of KCC2 5'-flanking region, exon 1, and ~11 kb of downstream sequence revealed that mouse KCC2 gene contains the sequence TTCAGCACCACGGACAGCGCC within intron 1 (205). This sequence was also observed within intron 1 in humans (380) and is 80% homologous to consensus site for a neuronal-restrictive silencing factor binding (NRSF). This NSRF is known to be responsible for negative transcriptional regulation of genes in nonneuronal cells (360). Mouse putative NRSE contains four mismatched nucleotides when compared with classical NRSE; however, three have been previously shown to be nonessential for NRSF binding (360). In addition, Karadsheh and Delpire (205) observed that the 21-bp fragment containing the putative NRSE was able to interact with proteins isolated from C17 nonneuronal cells and that addition of cold NRSE fragment displaced the binding. In addition, in a luciferase gene reported assay carried out in C17 cells, investigators observed that luciferase activity yielded by KCC2 promoter alone was completely prevented with KCC2 promoter construct also containing NSRE sequence.

SLC12A6 and SLC12A7 genes that encode KCC3 and KCC4 isoforms of K⁺-Cl^– cotransporters have been located at human chromosomes 15q13–14 and 5p15.3, respectively (178, 292). To date, however, complete gene or promoter regions have not been reported. Similarly, SLC12A9 cDNA encoding CIP was cloned from a human heart cDNA library, and the gene was located at human chromosome 7q22. The complete gene or promoter regions have not been described. Finally, by BLAST search analysis, the gene encoding SLC12A8 has been localized at human chromosome 3q21–22.

E. Phylogenetic and Sequence Comparison

Figure 4 shows the phylogenetic tree, and Table 4 shows the degree of identity obtained from alignment analysis of all members of electroneutral cotransporter family. Alignment was performed according to the Clustal W method using DNASTAR MegaAlign software. For this analysis, predicted sequences of human cotransporter proteins were used. As shown in Figure 4, two main branches are clearly separated: one branch is composed of cotransporters that utilize Na⁺ as cation in the coupled process, regardless of their use of K⁺, and include BSC1/NKCC2, BSC2/NKCC1, and TSC, while the remaining branch is composed of cotransporters that use K⁺ as a unique cation coupled with Cl^– include KCC1, KCC2, KCC3, and KCC4. As seen in Table 4, degree of identity between members of one branch with the other is ~25%. The K⁺-coupled Cl^– cotransporters branch is subdivided into two subfamilies: one composed of KCC1 and KCC3 that exhibit ~75% identity, and the other of KCC2 and KCC4 that share ~72% of amino acid residues. Identity between both KCC subfamilies is ~65%. Finally, overall identity of orphan members CIP and CCC9, between the two, and with the remainder of the family is ~20%.

View larger version (12K): [in this window] [in a new window]   FIG. 4. Phylogenetic tree of the electroneutral cation-coupled chloride cotransporter family SLC12. Numbers indicate degree of identity.

The carboxy-terminal domain (defined as the segment extending from first amino acid residue after transmembrane segment 12 to the end of the protein) is more conserved in the KCC branch than in Na⁺-coupled cotransporters. As shown in Table 4, among KCCs the percentage of identity in carboxy-terminal domain is similar to the degree observed within central hydrophobic domain, while in Na⁺-coupled cotransporters the identity is lower. The length of this domain ranges from 413 to 480 residues. An alternatively splicing isoform in BSC2/NKCC1 due to lack of 21 residues of the carboxy-terminal domain has been described. Consequences of the splicing are not yet known (332). As previously discussed, there is also evidence for a shorter carboxy-terminal domain-spliced variant in BSC1/NKCC2 (290). Modifications in the carboxy-terminal sequence and length confer upon the cotransporter with interesting changes in functional properties that are discussed in section IIIB. Finally, there are two unique regions within the carboxy-terminal domain. One in the Na⁺-K⁺-2Cl^– cotransporter of ~60 amino acid residues that is not present in TSC, which exhibits a degree of identity <13% between BSC1/NKCC2 and BSC2/NKCC1; thus this is a unique region in both cotransporters. The presence of several putative phosphorylation sites, including one putative PKA site in BSC2/NKCC1, suggests that this region may be associated with specific regulatory properties of each cotransporter. The remaining unique region belongs to KCC2. There are 73 amino acid residues in the carboxy-terminal domain of KCC2 that are not present in KCC1, KCC3, and KCC4. This region also contains several putative regulatory sites, including one for PKA phosphorylation.

	III. FUNCTIONAL PROPERTIES

Top Previous Next References

 
Since the discovery of these membrane transport systems, several investigators have studied in different cells and organisms the functional characteristics of the basolateral Na⁺-K⁺-2Cl^– and K⁺-Cl^– cotransporters. Characterization of the same cotransport system in several different cells has yielded important functional differences in which it is difficult to define whether they are related to the cotransporter protein itself, to species differences in the protein, or to the environment in which it was studied. In the case of K⁺-Cl^– cotransporter, most functional characterization has been carried out in erythrocytes and before knowing that there are four different genes encoding this cotransporter. We will not review here the functional characterization that has been performed in situ in cells expressing these cotransporters. For in-depth reviews about it see References 161, 162, 164, 235, 234, 337, 351, 427. Due to its unique and specific localization in the kidney, together with absence of reliable stable cell lines from TALH and DCT, functional characterization of apical Na⁺-K⁺-2Cl^– and Na⁺-Cl^– cotransporters has been less active (for review, see Refs. 19, 302, 348). In recent years, with identification and cloning of cDNA encoding all members of the family, in-depth characterization of the major functional, pharmacological, and some regulatory properties has been possible, increasing our understanding of the cotransporter process. In this section we review the functional characterization of each member of electroneutral cotransporter family that has been performed by means of functional expression assays of cloned cDNAs in mammalian (v.gr. HEK-293 cells, MDCK cells, etc.) or nonmammalian (v.gr. X. laevis oocytes) expression systems.

A. Thiazide-Sensitive Na⁺-Cl^– Cotransporter

As discussed in the previous section and shown in Table 1, TSC cDNA has been identified and cloned in fish from winter flounder urinary bladder (137) and in mammals from rat (136), mouse (221), rabbit (43), and human (265, 377) renal cortex. Heterologous expression of teleost, rat, mouse, and human TSC has been achieved in X. laevis oocytes (72, 136, 137, 221, 283, 352). This expression system has shown to be an excellent tool to obtain clean and reproducible TSC expression, whereas transfection in mammalian cells has not been successful. The best results obtained to date using wild-type TSC cDNA transfected into mammalian cells (MDCK cells) consisted of a small increase over background not >25% (74). Thus basically all TSC functional characterization has been performed using X. laevis oocytes as expression system.

Initial characterization of TSC was obtained after cloning of the flounder cotransporter, in which observations from Renfro (341) and Stokes et al. (389) were confirmed, i.e., that Na⁺ and Cl^– transport was indeed interdependent and specifically inhibited by thiazide-type diuretics, with an affinity profile similar to that previously shown for inhibition of Cl^–-dependent Na⁺ absorption in flounder urinary bladder, assessed as the short-circuit current (244) and for thiazide competition for high-affinity [³H]metolazone binding site on rat kidney cortical membranes (26). More recently, functional, pharmacological, and some regulatory properties of rat TSC (rTSC) (283), mouse TSC (mTSC) (352), and flounder (flTSC) (410) were described by assessing ²²Na⁺ uptake in X. laevis oocytes microinjected with cRNA in vitro transcribed from each of these orthologs. As shown in Table 5, a number of interesting differences were observed between fish and mammalian TSC. Analysis of ion transport kinetic properties revealed that apparent K_m values for Na⁺ and Cl^– in mammalian TSC proteins, either rTSC or mTSC, are significantly lower than K_m values observed in the teleost protein flTSC. K_m values of <10 mM for Na⁺ and Cl^– observed in rTSC by Monroy et al. (283) agree with previous observations by Velázquez et al. (412) that Na⁺ and Cl^– in DCT absorption were interdependent, with one-half maximal concentration of both ions ~10 mM; thus mammalian TSC exhibits significantly higher affinity for cotransported ions. Interestingly, in mammalian TSC, affinity for both ions is similar, whereas in teleost TSC, affinity for extracellular Cl^– is higher than affinity for Na⁺. The polythiazide > metolazone > bendroflumethiazide > trichloromethiazide > chlorthalidone inhibitory profile is similar between teleost and mammalian TSC, but flTSC exhibited lower affinity for every thiazide diuretic tested. One example is depicted in Figure 5 that shows dose-dependent inhibition of rTSC and flTSC expressed in X. laevis oocytes in a simultaneous experiment in which oocytes injected with each cotransporter cRNA were exposed to identical uptake mediums containing different concentrations of the drug. EC₅₀ values are shown in Table 5. In fact, at 10^–4 M concentration, certain thiazides such as trichloromethiazide and chlorthalidone reduced flTSC activity by only 68 and 46%, respectively (410), whereas the same concentration of all thiazides inhibited rTSC by >95% (283). Therefore, in TSC higher affinity for ions accompanies higher affinity for thiazides.

View larger version (16K): [in this window] [in a new window]   FIG. 5. Kinetics of metolazone inhibition of rat (rTSC) and flounder (flTSC) thiazide-sensitive Na+-Cl– cotransporter expressed in Xenopus laevis oocytes, as stated. rTSC and flTSC activity is expressed as percent of control 22Na+ uptake (60 min) in the absence of inhibitor.

Monroy et al. (283) proposed a different model for ion and diuretic interactions. This model is based on analysis of functional properties of rTSC expressed in X. laevis oocytes. In this model, it was observed that affinity for Na⁺ or Cl^– was changed as a function of counterion concentration in the uptake medium. For instance, the apparent K_m for extracellular Cl^– varied from 6.4 ± 1.7 to 21.2 ± 0.4 mM when extracellular Na⁺ concentration was 40 or 2 mM, respectively. Thus the lower the extracellular Na⁺ concentration, the lower the Cl^– affinity, supporting predictions advanced by Tran et al. (404) that Na⁺ increases Cl^– binding. However, a similar observation was obtained for affinity of extracellular Na⁺ because K_m values for Na⁺ moved from 7.2 ± 2.4 mM when extracellular Cl^– concentration was 40 mM to 41.9 ± 6.9 when Cl^– concentration in the uptake medium was 2 mM. These data suggested that binding of each ion is random but that it is nevertheless affected by concentration of the counterion. A similar observation was made with regard to metolazone affinity. When metolazone dose-response effect was performed in low Na⁺ or Cl^– concentration, it was observed that IC₅₀ was shifted to the left, indicating that the lower the Na⁺ or the Cl^– concentration, the higher the affinity for metolazone, suggesting that both ions compete with metolazone for binding in the cotransporter. Thus the proposed model included a random order of binding with both ions affecting affinity for the counterion and competing with thiazide diuretics (283). To date, data discussed in section IVA, in which some specific point mutations have been studied in TSC protein, appears to favor the Cl^– to metolazone interaction hypothesis. Interestingly, competition between ions and thiazides in TSC generated another functional difference between rat and flounder TSC because in the latter species, ion concentration has no effect on affinity for thiazide diuretics (410).

In addition to kinetic and pharmacological differences, mammalian and teleost TSC are differently regulated by cell volume because behavior of rTSC and flTSC is different in response to changes in extracellular medium osmolarity. rTSC activity is reduced by ~40% in hypotonicity, whereas flTSC activity is reduced in hypertonicity. Thus mammalian TSC is activated by cell shrinkage, while flounder TSC is activated by cell swelling. Because X. laevis oocytes were used for both experiments, this observation also suggests that a different response to cell volume changes is encoded within the cargo molecule.

B. Apical Bumetanide-Sensitive Na⁺-K⁺-2Cl^– Cotransporter

Apical and renal specific isoforms of the Na⁺-K⁺-2Cl^– cotransporter have been cloned and analyzed at the functional level from shark (134), rat (136), mouse (187, 290), rabbit (311), and human (384) kidney. Initial cloning demonstrated in X. laevis oocytes that the 1,095 amino acid residues isolated from rat outer medulla by Gamba et al. (136) induced appearance of significant ⁸⁶Rb⁺ uptake over background that was Na⁺ and Cl^– dependent, bumetanide sensitive, but metolazone and DIDS resistant. Simultaneously, Payne and Forbush (311) also cloned the Na⁺-K⁺-2Cl^– cotransporter cDNA from a rabbit outer medulla ZAP cDNA library. No functional expression was present, but as shown in Table 1, the investigators were able to isolate what appeared to be three alternatively spliced isoforms, due to the existence of three mutually exclusive cassette exons denominated A, B, and F. The same isoforms were later shown as present also in Na⁺-K⁺-2Cl^– cotransporter from mouse (187, 290) and human (384) kidney. As shown in Figure 6, differences among A, B, and F isoforms in exon sequence are subtle. The majority of amino acid residues are identical among A, B, and F isoforms. There are only three residues not conserved among the three isoforms (boxed in red in Fig. 6); in addition, few residues not conserved in one isoform are identical in the other two, i.e., are unique to one isoform. These include three residues in A isoform (highlighted in orange boxes), one residue in B isoform (highlighted in blue box), and four residues in F isoform (highlighted in green boxes). Because differences in the sequence of exon 4 are subtle, it was proposed that exon cassettes could endow the cotransporter with different ion affinities or even with different ion specificities. In this regard, Eveloff and Calamia (116) and Sun et al. (393) previously showed that rabbit and mouse TALH, respectively, exhibited expression of a K⁺-independent, but nonetheless bumetanide-sensitive Na⁺-Cl^– transport mechanism. However, the first functional characterization of Na⁺-K⁺-2Cl^– with each different cassette exon performed by Plata et al. (325) showed that the three murine isoforms (A, B, and F) of the SLC12A1 gene encode the Na⁺-K⁺-2Cl^– and not Na⁺-Cl^– cotransporter, suggesting that difference among spliced variants could be in ion transport or bumetanide-affinity kinetics. This hypothesis was also supported by intrarenal localization studies of Payne and Forbush (311), Igarashi et al. (187), and Yang et al. (447), which demonstrated by Northern blot analysis, in situ hybridization analysis with specific probes, and single-nephron RT-PCR, respectively, that these isoforms exhibited axial distribution along TALH of rabbit, mouse, and rat kidney, respectively. As shown in Figure 7, the F isoform was absent in cortical TALH (cTALH) and present in medullary TALH (mTALH), with higher levels of expression in the inner than in the outer stripe of the outer medulla. The A isoform is present in both cTALH and mTALH, with higher expression in the outer stripe of outer medulla, whereas the B isoform is present only in cTALH. No B isoform was observed in mTALH.

View larger version (16K): [in this window] [in a new window]   FIG. 6. Amino acid sequence of mutually exclusive cassette exons A, B, and F of mouse apical renal specific Na+-K+-2Cl– cotransporter. Red boxes depict amino acid residues that are different in the three exons. Orange boxes highlight the residues that are unique to isoform A, blue box the residue that is unique to isoform B, and green boxes the residues unique to isform F.

View larger version (21K): [in this window] [in a new window]   FIG. 7. Localization of the F, A, and B isoforms of apical Na+-K+-2Cl– cotransporter BSC1/NKCC2 along the thick ascending limb of Henle (TALH). Isoform F in green is mainly expressed in the inner strip of the outer medulla, isoform A is present all along the TALH, and isoform B is exclusively expressed in the cortical portion of the TALH.

As discussed later and shown in Table 1, a carboxy-terminal domain spliced isoform has been identified from a mouse outer medulla cDNA library (290). This shorter isoform contains 55 amino acid residues at the end of carboxy-terminal domain that are not present in the Na⁺-K⁺-2Cl^– cotransporter. Using rabbit polyclonal antibody against this 55 unique piece, Mount et al. (290) were able to demonstrate the existence of this shorter protein in mouse outer medulla by Western blot analysis. In addition, immunohistochemistry demonstrated that anti-BSC1-S antibody exclusively labeled TALH cells apical membrane. Labeling was heterogeneous because not all cells were positive, suggesting that some cells do and others do not express this shorter isoform. Staining decreased in frequency along individual medullary rays toward the cortex. In addition to observed cellular heterogeneity, staining of mTALH with BSC1-S antibody lacked sharp apical definition, suggesting a significant component of subapical expression.

Functional expression in X. laevis oocytes has suggested two different roles for this shorter BSC1-S isoform: as a regulatory molecule and as a cotransporter. As a regulatory molecule, BSC1-S exerts a dominant-negative effect on the longer Na⁺-K⁺-2Cl^– cotransporter isoform that can be abrogated by cAMP (325). In multiple experiments, Plata et al. (325) observed that BSC1-S reduced transport activity of the high-expressing BSC1-L isoform. This effect occurred irrespective of which of the mutually exclusive cassettes (A, B, and F) were included in coexpressed cRNAs. The possibility of competition for translation in BSC1-S/BSC1-L coinjected oocytes was ruled out, because coinjections of BSC1-L with unrelated cRNAs did not significantly reduce uptake. In addition, cAMP abrogated the inhibitory effect of BSC1-S isoform, suggesting a specific functional effect. Thus Plata et al. (325) concluded that the carboxy-terminal truncated isoform of SLC12A1 gene in mouse exerts a dominant-negative function on ion transport by the Na⁺-K⁺-2Cl^– cotransporter, a property that is reversed by cAMP. More recently, using a confocal microcopy strategy, in BSC1-L and BSC1-S proteins in which EGFP was attached in frame to the amino-terminal domain, Meade et al. (269) observed that the mechanism by which BSC1-S reduced Na⁺-K⁺-2Cl^– cotransporter activity is by preventing arrival of the cotransporter to the plasma membrane; again, this effect can be prevented by cAMP. Thus it is likely that in mouse mTALH, activation of the Na⁺-K⁺-2Cl^– cotransporter by hormones generating cAMP via their respective G_s-coupled receptors (v.gr. vasopressin) requires the presence of the shorter BSC1-S isoform. In this hypothesis, absence of cAMP allows BSC1-S to reduce cotransporter activity, while in the presence of cAMP, the BSC1-S negative effect upon the longer BSC1-L isoform is inhibited. In this regard, Mount et al. (290) observed that expression of BSC1-S is axially distributed along the TALH, because cTALH appears to express many fewer BSC1-S than mTALH segments. This heterogeneity may explain the observation that in mouse the vasopressin effect is present in mTALH but absent in cTALH (170).

The murine shorter isoform BSC1-S also exhibits activity as a cotransporter. Using X. laevis oocytes as an expression system, Plata et al. (323) observed that BSC1-S cRNA encodes a K⁺-independent, but nevertheless loop diuretic-sensitive, Na⁺-Cl^– cotransporter that requires exposure to hypotonicity for activation, by a mechanism that includes a shift in expression of the cotransporter protein from cytosol to plasma membrane. In addition, it was also shown that Na⁺-Cl^– transport function of BSC1-S in hypotonic media is inhibited by addition of cAMP and further stimulated by blocking PKA activity with H-89. In this regard, existence of a K⁺-independent, furosemide-sensitive Na⁺-Cl^– cotransporter in rabbit and mouse mTALH was proposed years before that by Eveloff and co-workers (11, 116) and Sun et al. (393), respectively. In rabbit mTALH cells exposed to hypotonicity, the furosemide-sensitive Na⁺-Cl^– cotransporter was apparent, whereas when cells were exposed to isotonicity, furosemide-sensitive Na⁺ uptake became K⁺ dependent, constituting the Na⁺-K⁺-2Cl^– cotransporter mechanism (116). A few years later, Sun et al. (393) using isolated perfused mouse mTALH tubules observed that vasopressin (i.e., cAMP) shifts the mode of apical cotransport from Na⁺-Cl^– to Na⁺-K⁺-2Cl^–. Taken together, these data indicate that in mTALH, when extracellular osmolarity is low (or cell swelling occurs by other means) and in the absence of vasopressin (or cAMP), transepithelial salt reabsorption is mainly due to an apical Na⁺-Cl^– cotransporter, encoded by the shorter carboxy-terminal domain isoform of SLC12A1 gene (323), whereas when extracellular osmolarity is increased and/or in the presence of vasopressin, the major salt transport pathway is the Na⁺-K⁺-2Cl^– cotransporter, encoded by BSC1/NKCC2, the long carboxy-terminal domain isoform of SLC12A1 gene (325).

C. Basolateral Bumetanide-Sensitive Na⁺-K⁺-2Cl^– Cotransporter

The Na⁺-K⁺-2Cl^– cotransporter basolateral isoform BSC2/NKCC1 has been identified at the molecular level from several mammalian sources and from shark rectal gland (Table 1). However, functional expression analysis has been performed only from human (314) and shark orthologs (189, 440). In both cases, characterization was obtained in HEK-293 cells transfected with corresponding cDNA. Affinity constants for transported ion and inhibition by bumetanide observed in these studies are shown in Table 7. It is obvious from the data in Table 7 that human Na⁺-K⁺-2Cl^– cotransporter exhibits significantly higher affinity for Na⁺, K⁺, and Cl^– compared with shark ortholog. In addition, affinity for bumetanide inhibition is also higher in mammalian than in shark cotransporter. This situation is similar to that discussed previously for rat and flounder TSC, suggesting that electroneutral cation-chloride cotransporters from mammalian sources exhibit higher affinity for ions that do their fish orthologs. As discussed in detail in section IVA, differences in ion and bumetanide transport affinity and inhibition, respectively, between human and shark Na⁺-K⁺-2Cl^– cotransporter have been exploited by Isenring and Forbush (192) to define major affinity modifier regions within the cotransporter. Two alternative spliced isoforms of mouse BSC2 have been reported by Randall et al. (332), and two different genes encoding basolateral isoforms in eel were reported by Cutler and Cramb (69); however, functional consequences are still unknown. In addition to characterization of human and shark cDNA clones mentioned previously, endogenous basolateral Na⁺-K⁺-2Cl^– cotransporter has been extensively characterized in situ from many different cells and tissues. Discussion of this information is beyond the scope of this work and has been extensively reviewed recently in excellent manuscripts to which the reader is referred (164, 192, 351).

Before molecular identification of four genes encoding isoforms of the K⁺-Cl^– cotransporter, the majority of functional characterization of this cotransport system was performed in red blood cells (235, 234). In this section, functional data obtained from each isoform by functional expression experiments are reviewed. To date, functional analysis of all four K⁺-Cl^– cotransporter (KCC) isoforms has revealed significant regulatory, kinetic, and pharmacological differences among KCC isoforms.

As shown in Table 8, five studies have dealt with some aspects of the functional properties of KCC1. Functional characterization of KCC1 was initially obtained by Gillen et al. (142) when KCC1 cDNA was first identified from rabbit, rat, and human sources. Rabbit isoform (rbKCC1) was used for functional expression experiments in HEK-293 cells. It was shown that transfection of HEK-293 cells with rbKCC1 cDNA produced a significant increase of an ⁸⁶Rb⁺ efflux mechanism that was activated by twofold when cells were exposed to hypotonicity. rbKCC1 activity assessed as Cl^–-dependent ⁸⁶Rb⁺ uptake was stimulated by NEM and inhibited by the presence of 2 mM furosemide, indicating that rbKCC1 indeed encoded a K⁺-Cl^– cotransporter with similar characteristics to those previously reported in erythrocytes (232, 233). Although ion transport kinetics for Cl^– and Rb⁺ dependency of ⁸⁶Rb⁺ uptake were assessed, K_m values were reported only as >25 mM for Rb⁺ and as >50 mM for extracellular Cl^–. In contrast, K_i values for loop-diuretic inhibition of ⁸⁶Rb⁺ uptake were more precisely measured as 59 ± 9 µM for bumetanide and 40 ± 4 µM for furosemide. Holtzman et al. (180) also used HEK-293 cells to study certain functional properties of KCC1 cloned from pig, human, and the nematode Caenorhabditis elegans. They showed that when transfected into HEK-293 cells all three KCC1 orthologs behaved as K⁺-Cl^– cotransporters that were twofold activated by hypotonicity.

View larger version (15K): [in this window] [in a new window]   FIG. 8. Functional expression of K+-Cl– cotransporter isoforms in Xenopus laevis oocytes microinjected with 10–20 ng of in vitro-transcribed cRNA per oocytes. Uptakes were performed under hypotonic conditions, in the presence (open bars) or absence (black bars) of extracellular chloride. 86Rb+ uptake in all isoforms was Cl– dependent and higher than uptake observed in water-injected oocytes. In contrast, inset shows behavior of the same batch of oocytes when 86Rb+ uptake was performed under isotonic conditions. KCC2 was the sole cotransporter in which uptake was significantly different from water-injected oocytes.

View larger version (22K): [in this window] [in a new window]   FIG. 9. Changes in intracellular pH after incubation of Xenopus laevis oocytes injected with cRNA encoding various K+-dependent cation-Cl– cotransporters in media containing different concentrations of NH4+. Acidification rates were recorded in noninjected oocytes or in oocytes expressing BSC1/NKCC2, KCC1, KCC3a, or KCC4, as stated. The recording in each panel is a representative example of a typical experiment from 4–11 oocytes. [Modified from Bergeron et al. (31).]

There are three reports available concerning functional properties of KCC2. After initial cloning of rat KCC2, Payne (310) performed a careful analysis of several functional characteristics of rat KCC2 as expressed in HEK-293 cells. As shown in Table 9, he observed that KCC2 was functional in isotonic conditions and that treatment with 1 mM NEM further increased KCC2 activity by twofold, while cell swelling had no effect on cotransporter activity. Ion transport kinetic analysis revealed that apparent K_m for K⁺ and Cl^– were ~6 and 101 mM, respectively, indicating that affinity for extracellular K⁺ was significantly higher than for extracellular Cl^–. These observations, together with the high level of neuronal-specific expression previously shown for KCC2, allowed the investigator to propose the hypothesis that KCC2 could be an important membrane protein to move Cl^– out of the cell, regulating intraneuronal Cl^– concentration and thus the type of response to certain neurotransmitters such as GABA. This major role of KCC2 was later confirmed (250, 346) and will be discussed in section VE. A second proposed possibility, with regard to the high affinity for extracellular K⁺ in KCC2 that is not present in KCC1 (see Table 8), was that KCC2 could play a fundamental role in buffering extracellular K⁺ concentration in CNS. Specifically, KCC2 was proposed to be one of the pathways that participate in reuptake of K⁺ that leaves cells during neuronal activity. In this scenario, efflux of K⁺ that normally occurs during heavy neuronal activity or during pathophysiological processes such as ischemia or hypoxia, results in increased concentration of extracellular K⁺ that in turns activates K⁺ influx by the cotransporter. In addition to K⁺, it has been shown that similar to KCC1, KCC3, and KCC4 (31), KCC2 is also capable of transporting NH₄⁺ (246, 432).

Apparent K_m for Rb⁺ transport that was observed by Song et al. (380) in 9.3 ± 1.8 mM is consistent with K_m observed for K⁺ influx by Payne (310); however, apparent K_m for Cl^– transport is totally different. A K_m value of ~7 mM was observed by Song et al. under both isotonic and hypotonic conditions, suggesting that the difference with regard to the Payne study is probably not due to the cell volume at which KCC2 was expressed. Because it is known that electroneutral cotransporters form homodimers (73, 284, 385) and due to the relatively low level of expression in HEK-293 cells, one potential explanation for this discrepancy is formation of heterodimers with an endogenously expressed K⁺-Cl^– cotransporter in HEK-293 cells, producing mixed kinetics. When X. laevis oocytes were used as an expression system, this possibility was unlikely to occur because, on one hand, although it is known that these cells express an endogenous K⁺-Cl^– cotransporter (xKCC) (272), activity of exogenously expressed KCC2 protein was 20-fold, suggesting that increased uptake was due solely to the exogenous cotransporter. On the other hand, kinetic analysis of xKCC revealed an apparent K_m for Cl^– influx of 15.4 ± 4.7 mM (272).

F. K⁺-Cl^– Cotransporter 3

As discussed in section IIB, KCC3a and KCC3b differ in length and sequence of amino-terminal domain due to the existence of two alternative exons 1, denominated 1a and 1b (315). When expressed in the X. laevis oocyte system, both isoforms induced the appearance of robust Cl^–-dependent ⁸⁶Rb⁺ uptake mechanism that was present only when oocytes were incubated in hypotonicity (Fig. 8) (273). Functional consequences of two different exons 1 have not yet been established.

Initial characterization of KCC3 was performed by Hiki et al. (178) in KCC3b. As shown in Table 10, similar to previous observations in KCC1 and KCC2, the investigators showed that when HEK-293 cells were used as the expression system, KCC3b was functional under isotonic conditions, slightly activated by NEM, but without further activation by cell swelling. Race et al. (331) also used HEK-293 cells to express KCC3a cloned from a human placenta cDNA library and observed slight activation under hypotonic conditions. They performed ion-transport kinetic analysis and obtained apparent K_m values for extracellular K⁺ and Cl^– of 9.5 ± 1.4 and 51 ± 9 mM, respectively. Affinity for K⁺ was lower than that shown in KCC1 (Table 8) and similar to KCC2 (Table 9), while affinity for Cl^– was significantly different from previous values in both KCC1 and KCC2. Real K_m values are difficult to define because investigators made it clear on one hand that kinetics were carried out in cells with a low level of KCC3 expression because it was impossible to obtain kinetic analysis in cells pretreated with NEM, and on the other hand that different numbers were obtained in each experiment. For instance, they mention that in 12 different experiments K_m observed for Cl^– varied from 6 to 60 mM with mean of 32 ± 4 mM, suggesting again that a low level of expression could be producing different types of heterodimers with an endogenous cotransporter. As shown in Table 10, using X. laevis oocytes as the expression system, Mercado et al. (273) observed robust activity of KCC3a and KCC3b during cell swelling, resulting in apparent K_m values for K⁺ and Cl^– that were ~10 mM, suggesting high affinity for cotransported ions, similar to that shown for KCC2. Another source of variability is that kinetic analysis was performed by different groups or by the same group but using different batch of oocytes, and different solutions. To define differences in kinetic properties of K⁺-Cl^– cotransporter isoforms in my laboratory, we have recently performed ion transport kinetics analysis of KCC1, KCC2, KCC3a, and KCC4 simultaneously, in the same experiment, using the same batch of oocytes and solutions. Uptakes were done under hypotonic conditions. Results from this analysis are shown in Figure 10. K⁺ and Cl^– transport kinetics were very similar among KCC2, KCC3a, and KCC4. Only KCC1 appears to be different, exhibiting a significantly lower affinity for both transported ions. K_m values for K⁺ transport in KCC1, KCC2, KCC3a, and KCC4 were 25.5 ± 3.2, 11.7 ± 2.76, 14.9 ± 2.68, and 10.2 ± 2.4 mM, respectively, whereas K_m values for Cl^– transport in the same order were 38.5 ± 11, 7.23 ± 0.8, 9.41 ± 1.9, and 5.6 ± 1.1 mM, respectively. Thus affinity profile for extracellular K⁺ and Cl^– among KCCs is KCC2 = KCC4 = KCC3 > KCC1. Finally, KCC3 was shown as the only variant in which ⁸⁶Rb⁺ uptake is better in the presence of an anion, different from Cl^–. Uptake in the presence of Br^– was slightly but significantly better than in the presence of Cl^–.

View larger version (19K): [in this window] [in a new window]   FIG. 10. Apparent Km values for K+ (A) and Cl– (B) in Xenopus laevis oocytes microinjected with 10–20 ng/oocytes cRNA in vitro transcribed from rabbit KCC1 (black), human KCC2 (green), human KCC3 (blue), or mouse KCC4 (red). 86Rb+ uptake experiments for each ion kinetic analysis (K+ or Cl–) were performed for all cotransporters in the same assay, using oocytes from the same frog, injected the same day and using the same hypotonic solutions. At the end of the uptake period, oocytes were dissolved in 10% sodium dodecyl sulfate, and tracer activity was determined for each oocyte by -scintillation counting.

There are only two reports that have addressed functional characteristics of KCC4. Initial characterization by Mount et al. (292) using X. laevis oocytes demonstrated that KCC4 cDNA encodes a K⁺-Cl^– cotransport mechanism that was not functional when oocytes were incubated under isotonic conditions, but that exhibited a >200-fold activation during cell swelling. Later Mercado et al. (275) performed a detailed characterization of KCC4 properties. It was shown in this study that similar to other KCCs, activation of KCC4 during cell swelling is also prevented by calyculin A, but not by okadaic acid and cypermethrin, suggesting a major role for PP1 in activating the cotransporter. Apparent K_m values for extracellular K⁺ and Cl^– were 17.5 ± 2.7 and 16.2 ± 4.2 mM, respectively, although more recent values obtained in my laboratory (Fig. 10) are somewhat lower. As shown in Figure 9, Bergeron et al. (31) demonstrated that KCC4 is also capable of transporting NH₄⁺ instead K⁺. The K_m value for Rb⁺ uptake in the presence of extracellular Rb⁺ was 12.3 ± 5.5 mM, while the K_m value for Rb⁺ uptake in the presence of NH₄⁺ was 13.5 ± 5.5 mM. These values revealed an affinity for NH₄⁺ similar to that shown for extracellular K⁺. Interestingly, Bergeron et al. (31) also showed that KCC4 is pH regulated. Maximal activity is reached at extracellular pH <7.0, and the cotransporter becomes inactive at pH >7.8. This is an important observation given the expression of KCC4 in intercalated cells of renal collecting duct, suggesting a role for this cotransporter in acid-base metabolism (see sect. VG).

Affinity for furosemide and bumetanide in KCC4 is the lowest of all isoforms. The IC₅₀ observed by Mercado et al. (275) for both furosemide or bumetanide was ~900 µM. Figure 11 is composed of dose-response curves for furosemide observed at my laboratory using X. laevis oocytes as the expression system for all four K⁺-Cl^– cotransporters. Data for each cotransporter were published separately for KCC1 and KCC4 by Mercado et al. (275), for KCC2 by Song et al. (380), and for KCC3a by Mercado et al. (273), but I wished to show this in the same figure to illustrate a clear difference in a functional property among K⁺-Cl^– cotransporters. In all cases, uptakes were performed for 1 h under hypotonic conditions, in the absence of extracellular Na⁺ and in the presence of 2 µCi ⁸⁶Rb⁺. Uptake observed in the absence of loop diuretic was taken as 100%. As Figure 11 shows, the affinity profile for furosemide in K⁺-Cl^– cotransporter isoforms is KCC2 > KCC1 = KCC3 > KCC4. It is intriguing that KCC2 and KCC4, which belong to the same subfamily of KCCs (Fig. 5), exhibit opposite affinity for the diuretics. The studies mentioned previously have also shown that K⁺-Cl^– cotransporter can be inhibited by >75% with 100 µM concentration of DIOA and DIDS, and by 20–30% with thiazide diuretics at a high concentration (2 mM).

View larger version (21K): [in this window] [in a new window]   FIG. 11. Kinetics of furosemide inhibition of the different K+-Cl– cotransporter isoforms expressed in Xenopus laevis oocytes. cRNA in vitro transcribed from KCC1 cDNA (shown in black), KCC2 cDNA (shown in green), KCC3 cDNA (shown in blue), or KCC4 cDNA (shown in red) was injected at ~12.5 ng/oocytes 4 days before the influx assays. 86Rb+ uptake was performed for 60 min in hypotonic solutions containing 20 mM K+, 50 mM Cl–, and 2 µCi/ml 86Rb+. Each KCC activity is expressed as percent of control 86Rb+ uptake in the absence of loop diuretic.

Two orphan members of the electroneutral cation-chloride cotransporter family have been described. Caron et al. (49) identified an mRNA encoding a protein of 915 amino acid residues that exhibit 25% identity with K⁺-Cl^–, Na⁺-K⁺-2Cl^–, and Na⁺-Cl^– cotransporters, but with a topology that remains K⁺-Cl^– cotransporters because the large extracellular glycosylated loop is located between transmembrane segments 5 and 6 (Fig. 1). The function of this protein is not known because its properties as a cotransporter have not been defined. Microinjections of X. laevis oocytes with a sufficient amount of good-quality cRNA resulted in no increase in ²²Na⁺, ⁸⁶Rb⁺, or ³⁶Cl^– uptake under several experimental conditions that included the following: 1) preincubation in hypertonic, isotonic and hypotonic medium; 2) changing uptake medium pH with NaOH or HCl; 3) replacing Rb⁺ with NH₄⁺, SO₄^2–, PO₄^2–, and Cl^– with gluconate, or Na⁺, Rb⁺, Ca²⁺, or Mg²⁺ with N-methylglucamine; 4) by increasing concentrations of either SO₄^2–, PO₄^2–, Ca²⁺, or Mg²⁺ severalfold; and 5) by adding amino acids at 1 mM. HEK-293 cells were also not useful for functional expression of this protein. Because functional interaction among other members of the family was shown as possible (325), interaction of CIP with KCC1, BSC1/NKCC2, and BSC2/NKCC1 was tested in X. laevis oocytes coinjected with CIP in addition to one of these cotransporter's cRNAs. Results showed that CIP had no effect on BSC1/NKCC2 or KCC1 activity, but consistently inhibited activity of BSC2/NKCC1 protein. Coimmunoprecipitation analysis suggested that the functional connection between CIP and BSC2/NKCC1 is a physical association between the two proteins.

The last member of the family to be identified is currently known as CCC9. It is a protein of 714 amino acid residues that exhibits the most distinct topology (Fig. 1). Functional expression in X. laevis oocytes under several experimental conditions has been unsuccessful (289); thus no functional properties for this membrane protein are known.

	IV. STRUCTURE-FUNCTION RELATIONSHIPS

Top Previous Next References

 
Interest of researchers in analysis of structure-function relationships in cation-chloride cotransporters began before molecular identification of each cotransporter. The first studies were performed by analyzing kinetics of ion binding with regard to the cotransporter in different cell types and kinetics of interactions between ions and inhibitors. Later, behavior of tracer ³H-inhibitor binding to membrane preparations from several cells was used as an index of cotransporter activity and thus was employed to propose some structure-function relationships. In these studies, observation that reduction in Cl^– concentration was associated with an increase in bumetanide affinity (165), together with the fact that increasing extracellular Cl^– concentration (but not Na⁺ or K⁺) resulted in decrease of [³H]bumetanide binding to membranes isolated from dog kidney outer medulla (128), suggested that Cl^– and bumetanide compete for the same site in the Na⁺-K⁺-2Cl^– cotransporter. Because a similar observation was done by Tran et al. (404) between [³H]metolazone and extracellular Cl^– in rat renal cortex-membrane preparations, it was also proposed that in TSC chloride and metolazone compete for the same site.

Cloning of cotransporter cDNAs increased the possibility to perform structure-function relationship studies, first by providing a topologic model of each cotransporter and second, because the possibility of designing chimeras between cotransporters and point-mutated clones became feasible. As shown in Figure 1 and Table 4, predicted topology is different between cotransporters using Na⁺ (with or without K⁺) or K⁺ (without Na⁺). Degree of identity between these two branches is not >25%. In contrast, within the Na⁺-coupled branch of the family, i.e., among Na⁺-Cl^– and Na⁺-K⁺-2Cl^– cotransporters, degree of identity is >50%. Thus differences in cation coupled with chloride (sodium vs. potassium) seems to be based on a slightly different structure, although several key functional properties are common among members in both branches of the family, such as coupling cations with chloride following an electroneutral fashion, sensitivity to similar inhibitors, and regulation by changes in cell volume.

A. Na⁺-Coupled Chloride Cotransporters

As previously discussed, the sole study in which proposed topology in one member of SLC12 family has been carefully analyzed was performed by Gerelsaikhan and Turner (140) in BSC2/NKCC1. It was concluded, as predicted by the Kyte-Doolittle algorithm, that BSC2/NKCC1 is composed by 12 membrane-spanning segments that are flanked by amino- and carboxy-terminal domains located within the cell. Transmembrane (TM) segments 1–8 exhibit the classical ~20 residue -helices and TMs 9–10 and 11–12 are ~36 residues in length, forming a hairpin-like structure in the membrane or making up either a nonhelical or a partial-helical structure. With degree of identity in central transmembrane domain of at least 60% between Na⁺-K⁺-2Cl^– and Na⁺-Cl^– cotransporters, it is reasonable to suggest that topology in BSC1/NKCC2 and TSC is similar to that in BSC2/NKCC1.

1. The Na⁺-coupled chloride cotransporter forms homodimers

Evidence has been obtained for Na⁺-K⁺-2Cl^– and Na⁺-Cl^– cotransporters that these proteins form homodimers in plasma membrane. Moore-Hoon and Turner (285) used rat parotid plasma membrane to analyze the basolateral Na⁺-K⁺-2Cl^– cotransporter BSC2/NKCC1 using the reversible chemical cross-linker 3,3'-dithiobis-(sulfosuccinimidyl propionate) (DTSSP). They observed that BSC2/NKCC1 migrates at ~335 kDa. After denaturation with a high concentration of Triton X-100, single monomers of ~170 kDa were obtained, in which the investigators were unable to detect the presence of any other protein. Further evidence of homodimer formation by BSC2/NKCC1 was provided by quantitative analysis of molecular sizes of oligomers formed by combinations of full-length BSC2/NKCC1 and amino-terminal truncated peptides of BSC2/NKCC1 expressed in HEK-293 cells; thus authors concluded that BSC2/NKCC1 in plasma membrane forms homodimers. Similar results were later observed on apical BSC1/NKCC2 by Starremans et al. (385) and TSC by De Jong et al. (73). In these studies, different strategies were used to assess dimeric conformation of cotransporters when X. laevis oocytes were injected with in vitro-transcribed cRNA from different FLAG- or HA-tagged wild-type cotransporters and concatamer constructions. Strategies used included chemical cross-linking experiments that revealed shifts in protein-band sizes from monomeric to multimeric compositions and coimmunoprecipitation assays in cotransporters previously tagged with FLAG and HA epitopes in the amino-terminal domain. These experiments revealed that FLAG-BSC1/NKCC2 and HA-BSC1/NKCC2 (385), as well as FLAG-TSC and HA-TSC (73), are physically linked. Sucrose gradient centrifugation in both cotransporters demonstrated that high molecular complexes have a molecular weight equivalent to a dimeric configuration. Finally, concatamer cotransporters were constructed by combining, in tandem, two wild-type monomers or a wild-type monomer with a mutant monomer containing one of the naturally occurring mutations in Bartter's or Gitelman's disease. In both cotransporters, when expressed in oocytes, concatamers containing wild-type monomers in tandem exhibited significant activity as bumetanide-sensitive Na⁺-K⁺-2Cl^– cotransporter (385) or thiazide-sensitive Na⁺-Cl^– cotransporter (73). A concatamer was constructed with a wild-type BSC1/NKCC2 monomer and a mutant monomer containing the Bartter type I mutation G319R. This mutation was selected because it was previously shown by the same group (384) that it affects Na⁺-K⁺-2Cl^– cotransporter activity, without reducing its insertion into plasma membrane. Results showed that concatamer protein was present in plasma membrane, but that activity was reduced by 50% when compared with double wild-type concatamer. Using a similar strategy, concatamers containing two wild-type TSC monomer or one wild-type monomers and a mutant G741R Gitelman-type monomer were constructed. The mutation selected was previously shown to produce a TSC protein not processed in oocytes, and thus mutant protein does not reach the plasma membrane (72). Functional expression experiments revealed that concatamer constructed with two wild-type monomers was functional, while concatamer containing a wild-type monomer and a mutant monomer was not active, because the protein did not reach the plasma membrane. Therefore, it was suggested that BSC1/NKCC2 and TSC function as homodimers in which both monomers interact with each other, because mutation in one monomer affected the function of both. It is possible, in addition, that members of the SLC12 family can build heterocomplexes among different members of the family. For instance, CIP does not appear to transport ions itself, but does appear to inhibit transport activity of BSC2/NKCC1 without any effect on BSC1/NKCC2 or KCC1, raising the possibility that CIP may form a heterocomplex specifically with BSC2/NKCC1 (49).

2. Affinity modifier domains or residues in the Na⁺-K⁺-2Cl^– cotransporter

The most extensive attempt to begin to understand structure-function relationship issues within the branch of Na⁺-coupled chloride cotransporters has been conducted by Isenring and Forbush (for review, see Ref. 192) in BSC2/NKCC1. These authors took advantage of kinetic differences in apparent affinity for ions and for bumetanide between shark and human BSC2/NKCC1 orthologs that exhibit 74% degree of identity. They first observed during their cloning effort of the human cotransporter (314) a higher affinity for ions and bumetanide inhibition in human BSC2/NKCC1, which is approximately sixfold higher than in shark ortholog. Subsequently, by means of single-point mutagenesis strategy to create a series of silent restriction sites along cDNA of both cotransporters, six chimera proteins between human and shark BSC2/NKCC1 were constructed in which amino-terminal, carboxy-terminal, or both domains were switched, one for the other (189). HEK-293 cells were transfected with corresponding cDNAs for functional characterization. Thus chimeras in which central hydrophobic transmembrane domain of human BSC1/NKCC2 was flanked by amino-terminal domain, carboxy-terminal domain, or both from shark ortholog, and vice versa, were analyzed. As shown in Figure 12, human and shark BSC2/NKCC1 exhibit significant differences in apparent K_m for Na⁺, K⁺, and Cl^– transport, as well as K_i for bumetanide inhibition, indicating that affinity for ions and bumetanide is higher in human cotransporter. As shown also in Figure 12, behavior of ion-transport and bumetanide-inhibition kinetics in all chimeric clones were determined by the source of central transmembrane domain, regardless of the source of both amino- and carboxy-terminal domains. These observations demonstrated the importance of central hydrophobic domain in defining affinity for cotransported ions and for inhibition by bumetanide.

View larger version (20K): [in this window] [in a new window]   FIG. 12. Apparent Km values for Na+, Rb+, and Cl– expressed in mM and Ki, as stated. Ion transport and bumetanide inhibitory kinetic analyses were performed in HEK-293 cells transfected with wild-type human or shark BSC2/NKCC1 cDNA (HHH and SSS, respectively) or with each of the chimeric proteins depicted in each graph. Black bars represent clones in which central transmembrane domain belongs to human cotransporter, whereas open bars represent clones in which this domain belongs to shark cotransporter. All clones are named with three letters. H, human; S, shark. The first letter indicates to whom the amino-terminal domain belongs (human or shark), the second letter indicates origin of central transmembrane domain, and the third letter indicates the origin of carboxy-terminal domain. For instance, the clone SHS is a chimera with central transmembrane domain from human BSC2/NKCC1 and both amino- and carboxy-terminal domains from shark. [Modified from Isenring and Forbush (189).]

Although no changes in Cl^–-transport affinity were observed, a clear change in bumetanide affinity occurred. Chimera with shark TM2 segment transplanted into human cotransporter exhibited bumetanide-affinity constant similar to that of the shark Na⁺-K⁺-2Cl^– cotransporter (0.76 vs. 1.04 µM, respectively), while chimera with human TM2 segment switched into shark cotransporter exhibited similar constant to human cotransporter (0.34 vs. 0.28 µM), suggesting that bumetanide affinity follows the second TM segment. Previous studies in which binding kinetics of tracer [³H]bumetanide to dog kidney outer medulla membrane preparation were assessed (128) and careful kinetic analysis of bumetanide and chloride interaction in duck red blood cells were determined (165) strongly suggested that bumetanide binds at one of the chloride sites of the cotransporter. Thus this observation was surprising because it was shown that TM2 chimeras exhibited no change in chloride-transport kinetics, together with an important switch in bumetanide affinity, suggesting that chloride- and bumetanide-binding sites are different.

Further construction of chimera clones between shark and human BSC2/NKCC1 demonstrated that switching TM 8–12 does not confer a difference in ion affinities between human and shark cotransporters (190). A chimera in which only TM7 was changed resulted in a cotransporter showing K_m for Na⁺, K⁺, and Cl^– with values that were intermediate between human and shark. Then, chimeras and point mutations in TM4 and TM5 demonstrated that some residues in TM4 affect K_m values for K⁺ and Cl^– but not for Na⁺. As shown in Figure 13, with all these results in which similarities and differences in structure and functional properties conferred by each TM segment were taken together (189–191), it was proposed that three TM segments play an important role in defining ion-transport kinetics in BSC2/NKCC1. Accordingly, TM2 is involved in Na⁺ and Rb⁺ kinetics, TM4 in Rb⁺ and Cl^– kinetics, and TM7 in Na⁺, Rb⁺, and Cl^– kinetics. Interestingly, as mentioned previously, behavior of several chimeric proteins in terms of bumetanide inhibition was completely different from behavior observed in ion-transport kinetics. Evidence was obtained that even TM 2–6 and 10–12 play a role in defining affinity for loop diuretics. Because several chimeras in which the same TM segments were switched from human to shark and vice versa did not exhibit mirror image behavior, authors were not able to develop models to explain their results, and it was proposed that bumetanide binding probably requires conformational interaction between TM and extracellular domains.

View larger version (34K): [in this window] [in a new window]   FIG. 13. Schematic representation of the proposed contribution of each transmembrane segment of BSC2/NKCC1 to fractional changes in apparent affinity for Na+, K+, and Cl– in chimeric proteins from human and shark BSC2/NKCC1. [Modified from Isenring and Forbush (192)].

Because these structure-function studies in Na⁺-K⁺-2Cl^– cotransporter were performed using spliced isoforms of BSC1/NKCC2 (133, 144, 324) or chimeras between orthologs of BSC2/NKCC1 (192), all constructs were anticipated to perform as Na⁺-K⁺-2Cl^– cotransporters. Therefore, although valuable information was obtained regarding structural requirements to define kinetic properties in both isoforms, it is possible that no information was obtained concerning structural requirements to define specificity for ions or diuretics. It has been shown, for instance, in glucose transporters that domains defining kinetic properties are not necessarily the same as those defining transport-process specificity or binding of a particular inhibitor (15, 299). In this regard, as shown in section IIIB, a carboxy-terminal domain of SLC12A1 in mouse behaves as a K⁺-independent but loop diuretic-sensitive, thiazide-resistant Na⁺-Cl^– cotransporter (323), suggesting that carboxy-terminal domain could be important to endow BSC1/NKCC2 with K⁺ transport ability. For this reason, Tovar-Palacio et al. (403) have recently taken advantage of homology between TSC and BSC1/NKCC2 to design chimeric proteins in which both amino- and carboxy-terminal domains were switched between cotransporters. Interestingly, the majority of chimeras were functional. Figure 14 shows the chimera TBT in which the central hydrophobic domain of the Na⁺-K⁺-2Cl^– cotransporter BSC1/NKCC2 is flanked by amino- and carboxy-terminal domains of the Na⁺-Cl^– cotransporter TSC. The graph below shows that ⁸⁶Rb⁺ uptake was Cl^– dependent, and bumetanide sensitive but metolazone resistant. This is a behavior identical to BSC1/NKCC2, indicating that residues that endow BSC1/NKCC2 with these functional properties are located within the central hydrophobic domain. Although overall identity between rat BSC1/NKCC2 and TSC is 52% (136), degree of identity varies along the central hydrophobic domain in such a way that >85% is present in 6 of 12 transmembrane helices (1, 2, 3, 6, 8, and 10), 55–75% in two helices (4 and 9) as well as in interconnecting segments facing intracellular side, and <50% in four transmembrane domains (5, 7, 11, and 12) and interconnecting segments facing the extracellular side of the cotransporters, pointing out to these divergent sequences within the central TM as the more likely regions of the cotransporters to contain the specificity-defining residues for both ion transport and diuretic sensitivity.

View larger version (21K): [in this window] [in a new window]   FIG. 14. Functional properties of TBT chimera (A) in which central hydrophobic domain belongs to BSC1/NKCC2 (in red) while both amino- and carboxy-terminal domains belong to TSC (in blue). Black region represents the sequence encoded by BSC1/NKCC2 exon 4 that generates alternative splicing isoforms A, B, and F. The injection of TBT cRNA into Xenopus laevis oocytes (B) induced the appearance of an 86Rb+ uptake mechanism that is evident in the presence of Na+, K+, and Cl– (open bars). Increased uptake is reduced in the absence of extracellular Cl– (black bar), or in the presence of 10–4 M bumetanide (red bar), but is not affected by 10–4 M metolazone (blue bar). [Modified from Tovar-Palacio et al. (403).]

In an attempt to analyze functional roles of certain selected residues in BSC2/NKCC1, Dehaye et al. (76) used the substituted cysteine accessibility method in which potential residues in BSC2/NKCC1 are replaced by cysteines and then the effect of cysteine-specific reagents, such as 2-aminoethylmethanethiosulfonate (MTSEA) or 2-(trimethylammonium) ethyl methanethiosulfonate (MTSET), on functional properties of the cotransporter was assessed. If certain residues play a role in defining functional properties, it is expected that cysteine substituting for a particular residue will interact with MTSEA or MTSET, resulting in a change of that particular property for which the residue under study is responsible, whereas if the cysteine substitute is a noncritical residue, interaction with MTSEA or MTSET will have no functional consequence. In this study, Dehaye et al. (76) mutated several residues to cysteine (S311, Val-312, Ala-316, Ala-405, Ala-528, and Ser-530) that were previously suggested, mainly by the Isenring and Forbush studies discussed previously, to be at or near binding sites for sodium, potassium, or chloride on BSC2/NKCC1. None of these mutations, however, rendered BSC2/NKCC1 sensitive to cysteine specific reagents, suggesting that mutated residues could be inaccessible to sulfhydryl reagents. It was observed, however, that mutating the amino acid A483 to cysteine, a residue located in TM6, rendered the cotransporter sensitive to MTSEA or MTSET, indicating that A483 plays an important functional role. Further functional analysis revealed that A483C substitution had no effect on ion-transport affinity but resulted in a remarkable sixfold increase in bumetanide affinity, suggesting that TM6 is associated with bumetanide binding.

4. Regulatory motifs in BSC2/NKCC1 amino-terminal domain

It is well known that activity of the Na⁺-K⁺-2Cl^– cotransporter is tightly regulated because activity of this cotransporter should be coordinated with chloride-extrusion mechanisms. On one hand, in its basolateral version BSC2/NKCC1 represents an important pathway to provide cells with chloride ions that will be secreted in the apical membrane, mainly through a cystic fibrosis transmembrane conductance regulator (CFTR)-related mechanism. On the other hand, in TALH cells chloride ions reabsorbed through the apical version of the cotransporter BSC1/NKCC2 are transported out of the cell into renal interstitium by chloride channels known as CLC-KB. The basolateral isoform may remain inactive until stimuli such as cell shrinkage or secretagogues acting by means of G_s-coupled receptors activate the cotransporter by a process that requires phosphorylation. In contrast, the apical isoform is usually active, but activity level is under tight control by hormones acting also through G_s-coupled receptors, such as vasopressin, parathyroid hormone, and isoproterenol.

It has been firmly established that Na⁺-K⁺-2Cl^– cotransporter regulation is associated with phosphorylation/dephosphorylation of the cotransporter protein. When BSC2/NKCC1 is activated by several different stimuli, the protein becomes phosphorylated, while inhibition of the cotransporter function is associated with dephosphorylation. In addition, cell treatment with the protein phosphatase 1 inhibitor calyculin A prevents cotransporter dephosphorylation, hence increasing its activity. Although BSC2/NKCC1 is activated when cells are exposed to hormones acting through G_s-coupled receptor producing cAMP (e.g., isoproterenol), the cotransporter does not appear to be phosphorylated by a PKA-dependent mechanism (222, 223). Several lines of evidence strongly suggest that intracellular chloride concentration is the common pathway to regulate the cotransporter. When intracellular chloride concentration falls, the cotransporter becomes phosphorylated; in contrast, when chloride concentration rises, the cotransporter is dephosphorylated and therefore inhibited. For instance, it has been postulated that increase of intracellular cAMP levels is responsible for increasing chloride extraction in apical membrane by activating CFTR, a well-known PKA substrate, and that consequential decrease in intracellular chloride due to improved secretion is what triggers activation of BSC2/NKCC1 (255). A similar situation was proposed several years ago by Greger and Schlatter (155) regarding the mechanisms by which vasopressin activates salt reabsorption in TALH. A critical review of studies regarding regulation of Na⁺-K⁺-2Cl^– cotransporter function by shrinkage or intracellular chloride is beyond the scope of this work. Interested readers are referred to several excellent reviews published specifically in this subject in recent years (124, 164, 351). What I want to present here is recent information regarding structure-function studies revealing that at least part of the regulatory phosphorylation/dephosphorylation of BSC2/NKCC1 occurs in threonine residues located within amino-terminal domain, together with protein motifs known to be associated with binding of kinases or phosphatases, indicating that this domain plays an important role in defining regulatory properties of the cotransporter.

The first study that presented evidence suggesting that activation of BSC2/NKCC1 cotransporter was associated with phosphorylation of a threonine residue was reported by Lytle and Forbush (254), who used suspensions of shark rectal gland tubules in which they demonstrated that maneuvers such as addition of cAMP or cell shrinking were associated with activation of the cotransporter, assessed as an increment of [³H]benzmetanide binding. Then, by immunoprecipitation with specific monoclonal antibodies against BSC2/NKCC1, they were able to show that activation was associated with cotransporter phosphorylation. Extensive protein digestion together with two-dimensional, thin-layer electrophoresis on cellulose plates allowed them to show that the phosphorylation pattern was similar among different stimuli, and to isolate the peptide FGHNTIDAVP that became phosphorylated in the threonine residue. A few years later, when shark BSC2/NKCC1 cDNA was identified at the molecular level (440), it was shown that this peptide corresponds to amino acid residues 184–194 that are located within the amino-terminal domain. Supporting this observation, Kurihara et al. (222) demonstrated that BSC2/NKCC1 from rat parotid gland is phosphorylated in the amino-terminal domain when activated by isoproterenol. Because it is known that no putative PKA phosphorylation sites are present in BSC2/NKCC1 amino-terminal domain, the same group in a follow-up study (223) observed that although PKA is involved in isoproterenol activation of BSC2/NKCC1, another unknown factor located beyond PKA activation must be present. This other factor can be another kinase cascade that phosphorylates the cotransporter in a threonine residue that is not part of a PKA-putative site. In this regard, it has been demonstrated in avian erythrocyte Na⁺-K⁺-2Cl^– cotransporter that all tested activators of BSC2/NKCC1 resulted in cotransporter phosphorylation with a similar pattern in phosphoamino acid analysis (252), suggesting use of a common final pathway to activate the cotransporter. In this study, however, phosphorylation was observed to occur in both amino- and carboxy-terminal domains because phosphorylated cotransporter was immunoprecipitated with monoclonal antibodies and chemically fragmented with N-chlorosuccinimide to produce two major ³²P-labeled fragments of 82 and 41 kDa, respectively, from which the smaller one was recognized with specific monoclonal antibody raised against the BSC2/NKCC1 carboxy-terminal domain, suggesting that serines or threonines in the carboxy-terminal domain also become phosphorylated during cotransporter activation.

Careful phosphopeptide analysis and phosphorylation stoichiometry measurements performed by Darman and Forbush (71) in shark rectal gland BSC2/NKCC1 after maximal stimulation with a combination of calyculin A, to prevent PP1 activity and hence dephosphorylation, and forskolin, to stimulate G_s-coupled receptor mechanisms, demonstrated that an average of 3.0 ± 0.4 phosphates/mol of cotransporter was incorporated, suggesting that at least three sites on the cotransporter are phosphorylated after exposure to these agents. Exhaustive trypsin digestion and separation of peptides by HPLC followed by matrix-assisted, laser desorption ionized mass spectrometry were used to identify three phosphoacceptor amino acid sites within the cotransporter amino-terminal domain. These residues were all threonines located at amino acid numbers 184, 189, and 202. Functional significance of these sites was tested by eliminating each one by means of point mutations. Mutant clones were expressed in HEK-293 cells. This analysis revealed that the most important site is threonine-189 because substitution of this residue with alanine resulted in complete inhibition of cotransporter, suggesting that phosphorylation of this residue is required to achieve constitutive activity. Interestingly, it was observed that BSC2/NKCC1 activity in HEK-293 cells transfected with the mutant T189A was lower than in nontransfected cells, suggesting that nonactive T189A cotransporter applies a dominant negative effect on the endogenous cotransporter, similar to what has been shown to occur with nonactive variants in BSC1/NKCC2 (325), KCC1 (50), and CIP (49). Elimination of threonine-184 or -202 resulted in normally active cotransporters. However, in-depth analysis revealed that threonine-184 is a residue required to achieve a response to intracellular chloride similar to that observed in wild type, because mutant T184A becomes activated only when exposed in preincubation to the lowest chloride-containing media. Finally, threonine-202 was also shown as required for activation of BSC2/NKCC1 by low intracellular chloride, but the difference with wild type was less pronounced. In addition, the same group performed studies in vivo using a specific antiphospho-BSC2/NKCC1 antibody denominated R5, which was raised against a synthetic peptide of amino-terminal domain containing threonine-212 and -217 of human BSC2/NKCC1 (corresponding to threonine-184 and -189 of shark BSC2/NKCC1). Results demonstrated that phosphorylation correlates with functional activation of the cotransporter by isoproterenol in rat parotid gland and respiratory epithelium (126). Finally, supporting the conclusion that threonine residues in the amino-terminal domain play a key role in regulation of BSC2/NKCC1 activity by several different effectors (cell shrinkage, intracellular chloride, isoproterenol, forskolin), Darman et al. (70) showed that BSC2/NKCC1 contains a PP1-binding site in the amino-terminal domain near the phosphorylation sites. It is known that to perform its specific action on particular serine or threonine residues, PP1 must bind to a motif that should be adjacent to the residues that will be dephosphorylated, thus preventing indiscriminate effects of PP1 in several phosphoproteins (60). The binding motif for PP1 catalytic subunit is known as RVxF, although highly conserved variations of the consensus are also functional, allowing a more broad motif to be (R/K)(V/I)xF. Darman et al. (70) observed that the amino-terminal domain of human BSC2/NKCC1 contains the sequence RVNFVD and demonstrated that mutagenesis designed to eliminate the motif resulted in cotransporters that exhibited higher activity than wild-type control at any chloride concentration in preincubation media. Furthermore, improving the binding capacity of the motif by adding acidic residues to obtain KRVRFED resulted in a BSC2/NKCC1 protein nearly impossible to activate at any chloride concentration. These observations are consistent with higher levels of phosphorylation in mutant BSC2/NKCC1; in other words, elimination of the PP1c motif seems to decrease the ability of PP1 to dephosphorylate the cotransporter. Finally, it was also shown that BSC2/NKCC1 is specifically coprecipitated with PP1c, suggesting that interaction between cotransporter and PP1 takes place.

Another regulatory motif recently shown as present in BSC2/NKCC1, as well as in other members of the cation chloride cotransporter family, is a motif that serves as a recognition site for two regulatory proteins known as Ste20-related proline-alanine-rich kinase (SPAK) and oxidative stress response 1 (OSR1). These are closely related serine/threonine kinases exhibiting amino acid identity of 67%. SPAK was originally cloned from rat brain (SPAK) and is located in human chromosome 2q31.1 (407). SPAK's physiological role or substrate has not been elucidated, but its expression has been localized to neurons and to transport epithelial cells that are rich in Na⁺-K⁺-ATPase. OSR1 was identified by means of large-scale DNA sequencing of a genomic region on chromosome 3p22-p21.3 (399). Association between SPAK and members of the electroneutral cation chloride cotransporter family was evidenced by Piechotta et al. (322) following a yeast two-hybrid screen designed to search for proteins that interact with K⁺-Cl^– cotransporter isoform KCC3a. Using the same system, they showed that SPAK and OSR1 were able to interact with other members of the family including KCC3b, BSC1/NKCC2, and BSC2/NKCC1, but not with KCC1 or KCC4, despite high conservation on the minimal requirement for SPAK binding domain determined in KCC3a (see Fig. 15). KCC2 and TSC were not included in the analysis because these cotransporters lack the minimal SPAK-binding motif (R/K)FX(V/I). This motif was shown to be present at the amino-terminal domain: once in KCC3a, KCC3b, and BSC1/NKCC2 and twice in BSC2/NKCC1. In this last cotransporter, the motif RFQVDPESV is located 76 residues downstream of the first methionine, and a second motif RFRVNFDPA is located 48 amino acid residues after the first and overlaps with the PP1 motif discussed previously (RVxF) (Fig. 16). Piechotta et al. (321) raised a polyclonal antibody against SPAK that together with anti-BSC2/NKCC1 antibodies were used to demonstrate that both proteins can be coimmunoprecipitated from brain tissue, indicating its physical interaction. Finally, immunohistochemical studies of choroid plexus and salivary gland revealed that both BSC2/NKCC1 and SPAK were coexpressed in the apical membrane of choroid plexus and basolateral membrane of salivary gland, suggesting their functional association. Furthermore, in the choroid plexus of BSC2/NKCC1 knockout mice, the SPAK signal was found solely in the cytoplasm.

View larger version (22K): [in this window] [in a new window]   FIG. 15. Conservation of phenylalanine and valine in the amino-terminal domain of several members of the cation chloride cotransporters family, in which the first five (in blue and picture at right) physically interact with SPAK. In contrast, KCC1 and KCC4 (in red and picture at right) do not interact with SPAK. Note the presence of the motif (R/K)FX(V/I) in the first five members, not present in KCC1 and KCC4. [Modified from Piechotta et al. (322)].

View larger version (30K): [in this window] [in a new window]   FIG. 16. Proposed model of amino-terminal domain and the first two transmembrane segments of BSC2/NKCC1 based on human sequence. Each circle represents an amino acid residue, and all red circles depict residues identical between human and shark BSC2/NKCC1. Shown in blue are the three threonines suggested as phosphorylation sites, in black a single PP1-binding motif, and in green two SPAK-binding motifs. All proposed motifs are located in highly conserved areas.

5. The thiazide-sensitive Na⁺-Cl^– cotransporter

The thiazide-sensitive Na⁺-Cl^– cotransporter TSC has also been subjected to studies designed to reveal some aspects of structure-function relationship in this cotransporter. These studies, however, have been based on guided/point mutations to show the role of specific amino acid residues, rather than on working with big fragments of cotransporters to expose functional roles of a particular domain. Some of these studies were carried out by searching for functional effects of certain amino acid residues found to be mutated in patients with Gitelman's disease (72, 221, 352). Information from these studies with Gitelman's disease mutations will be discussed in detail in section VIA.

Hoover et al. (181) demonstrated that glycosylation is essential to normal TSC function. As discussed in section IIA, mammalian TSC contains two putative N-glyscosylation sites within the extracellular loop located between TM7 and TM8 (136). Flounder TSC, in contrast, contains three putative sites, one of which is conserved with mammalian TSC (137). Hoover et al. (181) first demonstrated that TSC is glycosylated in vivo because molecular weight of TSC protein from rat kidney is reduced after enzymatic deglycosylation with protein N-glycosidase F, from a broad band of 135–150 kDa to a sharp band of 113 kDa, corresponding to TSC core molecular weight. Then, point mutations that eliminate each or both glycosylation sites revealed that TSC activity is reduced when glycosylation is prevented. Elimination of one site (either N204 or N242) resulted in a 50% reduction of TSC activity, while elimination of both sites was associated with a >95% reduction. Western blot analysis, however, showed that nonglycosylated proteins of the expected core size for TSC (~113 kDa) were produced, suggesting that absence of glycosylation is associated with cotransporter-aberrant processing, thus reducing its expression in plasma membrane. Supporting this hypothesis, confocal image analysis of EGFP-wild-type and EGFP-mutant TSC demonstrated significant reduction in mutant EGFP-TSC protein in plasma membranes when glycosylation was prevented. An interesting observation made in this study is that prevention of glycosylation was associated with increased affinity for extracellular Cl^– and metolazone; no increase in affinity for extracellular Na⁺ was observed. As shown in Figure 17A, single glycosylation mutants exhibited a rise in metolazone affinity that was further increased in the double mutant, suggesting that sugar moieties in native TSC inhibit access of diuretics to its binding site. This effect was accompanied by an increase in Cl^– affinity, supporting the proposal of Tran et al. (404) that thiazide-type diuretics and chloride bind to the same site on the cotransporter.

View larger version (24K): [in this window] [in a new window]   FIG. 17. Metolazone affinity of rat TSC. A: effect of prevention of glycosylation on metolazone affinity in rat TSC. Uptakes were performed in oocytes injected with wild-type TSC (black), single mutant N404Q TSC (blue), single mutant N424Q (green), and double mutant N404,424Q (red). Uptake was normalized taking as 100% of each group that was incubated in the absence of metolazone. [Modified from Hoover et al. (181).] B: effect of extracellular Cl– concentration and single nucleotide polymorphism G264A on thiazide affinity in rat TSC. Uptakes were performed in oocytes injected with wild-type TSC (blue) and G264A TSC (red) by using uptake solutions containing extracellular Cl– concentration of 96 mM (continuous lines and solid symbols) or around apparent Km for each clone that was 6 mM in wild-type and 1 mM in G264A (discontinuous lines and open symbols). [Modified from Moreno et al. (287).]

Functional analysis of Gitelman-type mutations that reduce, but do not completely inhibit, TSC function revealed that one mutation (G627V) located at the beginning of the carboxy-terminal domain exhibits an increase in both Cl^– and metolazone affinity (352). Thus, to date, the possibility that thiazide-type diuretics and Cl^– bind to the same site in the cotransporter in a competitive fashion is supported by mutation or substitution of single residues in three different locations along TSC that include two glycosylation sites, a single nucleotide polymorphism a G264A polymorphism, and a Gitelman-type mutation. In all cases, increased affinity for extracellular Cl^– and metolazone was observed, with no effect on Na⁺ affinity.

B. K⁺-Coupled Chloride Cotransporters

There is basically no information at present regarding structure-function relationship in K⁺-Cl^– cotransporters. On one hand, no specific inhibitor is known to be able to prepare tracer ³H-inhibitor, as was accomplished with [³H]bumetanide (163) and [³H]metolazone (26) for Na⁺-K⁺-2Cl^– and Na⁺-Cl^– cotransporters, respectively, to assess binding behavior on cell membrane preparations and the effect that physiological or pathophysiological maneuvers may have on binding properties. Even if this were possible, it would probably produce confounding results because we know that the majority of tissues express two, three, or even four K⁺-Cl^– cotransporter isoforms. On the other hand, molecular identification of K⁺-Cl^– cotransporters came several years after Na⁺-Cl^– and Na⁺-K⁺-2Cl^– cotransporters cDNA were cloned. Thus molecular tools for studying K⁺-Cl^– cotransporters have been available for a few years. Furthermore, the unexpected finding of four different genes coding for similar cotransporters has persuaded investigators to define fundamental questions such as physiological role that each isoform may have at both cellular and individual organ levels. Thus several publications regarding functional properties, tissue distribution, and immunohistochemical analysis on several tissues and production of knockout mice of each cotransporter have been reported.

The only study dealing specifically with a structure-function relationship to date was done by Strange et al. (390). It is well known that regulation of K⁺-Cl^– cotransporter activity by phosphorylation follows a mirror image as do those of the Na⁺-K⁺-2Cl^– cotransporter, i.e., phosphorylation of the K⁺-Cl^– cotransporter is associated with inactivation of the protein, whereas dephosphorylation is associated with increased cotransporter function. For instance, the PP1 inhibitor calyculin A, by preventing dephosphorylation of these proteins, increases activity of the Na⁺-K⁺-2Cl^– cotransporter but reduces the function of the K⁺-Cl^– cotransporter (for review, see Refs. 62, 125, 235, 291); according to these observations, when expressed in X. laevis oocytes, activation of KCC cotransporters by hypotonicity is prevented by calyculin A (275, 390). Because it has been suggested that tyrosine kinase is involved in regulation of K⁺-Cl^– cotransporter activity (125), Strange et al. (390) studied the role of a conserved tyrosine residue located in the carboxy-terminal domain of all four KCCs, corresponding to Y1087 in KCC2. They observed that substitution of this tyrosine with aspartate, a mutation that mimics phosphorylation, reduced basal activity of KCC2 in isotonic conditions by 80% and completely blocked further activation of the cotransporter by cell swelling. The effect was not associated with reduction in the immunofluorescence signal in plasma membranes of oocytes expressing Y1087D, compared with wild-type KCC2, indicating that traffic of mutant protein to cell surface was not affected. However, further experiments using selective tyrosine phosphatase inhibitors failed to show any effect on KCC2 cotransporter function. The authors concluded that Y1087 plays an important role in normal cotransporter function, but that it does not regulate cotransporter activity by functioning as a residue for tyrosine phosphorylation.

	V. PHYSIOLOGICAL ROLES

Top Previous Next References

 
Electroneutral cation-chloride cotransporters are membrane proteins that translocate Cl^– together with a cation that can be Na⁺, K⁺, or both, maintaining the requirement of electroneutrality by using Na⁺-Cl^–, K⁺-Cl^–, or Na⁺-K⁺-2Cl^– stoichiometry. As with other solute cotransporters, all ions must be present to allow conformational changes to occur that are required to move ions from one side of the membrane to the other. Each cotransporter can potentially move ions from inside to outside, or from outside to inside, the cell. Because these are secondary transporters, however, movement of ions will depend on preestablished gradients sustained by primary transporters, of which the most important is Na⁺-K⁺-ATPase; in doing so, it is the cation gradient that dictates the direction in which Cl^– are moved. Therefore, cotransporters that utilize Na⁺ as the driving force translocate cotransported ions from outside the cell to inside, because Na⁺ concentration is higher in the extracellular space. In contrast, cotransporters that use K⁺ as the driving force translocate K⁺-Cl^– from inside the cell to the extracellular space, due to the higher concentration of K⁺ within the intracellular compartment. Because Na⁺ and K⁺ are quickly returned to the extracellular or intracellular space, respectively, by Na⁺-K⁺-ATPase, the activity of these cotransporters usually changes the intracellular Cl^– concentration. Thus the SLC12 family is made up of membrane transporters capable of setting intracellular chloride concentration below or above equilibrium. Therefore, this is one of the major functions of these cotransporters at the cell physiology level (for a recent and excellent review of intracellular Cl^– regulation, see Ref. 7).

Another major function of electroneutral cation-chloride cotransporters is their well-known role as membrane proteins that participate in cell volume regulation. Because these cotransporters possess an important ion efflux or influx capacity, and some are ubiquitously expressed, their activation is one of the mechanisms that diverse cells use to adjust their internal osmolarity when they are exposed to changes in extracellular osmolarity. When cells are exposed to increased osmolarity in the extracellular medium, water content of the cell is reduced because water molecules move toward the space in which water is less concentrated; this is followed by a significant reduction in cell volume. To compensate for osmolarity differences between intra- and extracellular space, several mechanisms are activated to increase intracellular ion concentration, thus reducing the gradient for movement of water molecules outside the cell. One of these pathways is the Na⁺-K⁺-2Cl^– cotransporter, particularly the basolateral and ubiquitously expressed isoform BSC2/NKCC1, which by concentrating Na⁺, K⁺, and Cl^– into cells promotes recovery of the original cell volume. Thus Na⁺-K⁺-2Cl^– cotransporter is a membrane protein activated during regulatory volume increase (RVI) (for a complete and recent review, see Ref. 351). In contrast, when cells are exposed to a decrease in extracellular osmolarity, the gradient now favors movement of water molecules into the cell, resulting in cell swelling. Under these circumstances, membrane proteins that allow efflux of ions are activated to release effective osmolytes from the cell, and thus reduce the gradient for water movement. K⁺-Cl^– cotransporters are some of the pathways activated under these circumstances. By extruding ions, KCCs help to decrease intracellular osmolarity, thus K⁺-Cl^– cotransporters are membrane proteins that are activated during regulatory volume decrease (RVD) (for an excellent review of mechanisms involved in RVI and RVD, see Ref. 230).

A third universal role for electroneutral cotransporters is their important participation in transepithelial movement of ions. The only member of the family not involved in this activity is KCC2, because its expression is neuron specific. When expressed in epithelial cells, electroneutral cotransporters are polarized to the apical or basolateral membrane. Two genes of the family encode for cotransporters that are currently believe to be expressed only in the apical membrane of particular regions of the nephron. These are TSC, which is present only in DCT (20, 48, 106, 248, 301, 327, 400, 447), and BSC1/NKCC2, which is only expressed in TALH (98, 203, 290, 297). The major role of these isoforms is translocation of ions from the lumen into cells to promote transepithelial transport, thus playing a key role in reabsorption of salt in the kidney. In contrast, in epithelial cells BSC2/NKCC1 is only expressed in basolateral membrane [except in choroid plexus, which exhibits expression in apical membrane (326, 438)], the major function of which is to provide Cl^– that are required for secretion in the apical membrane. K⁺-Cl^– cotransporters KCC1, KCC3, and KCC4 are all expressed in several epithelial cells, but precise localization of each isoform is not completely known (see below). However, it is highly likely that these cotransporters are also involved in transepithelial ion transport.

Finally, a fourth and emerging role of electroneutral cotransporters is their participation in clamping intraneuronal chloride concentration either above or below its electrical potential equilibrium (6). This role in neuronal physiology is critical to define type and magnitude of response to neurotransmitters such as GABA. Family members involved in this activity are those expressed in the CNS, with particular importance on BSC2/NKCC1, KCC2, and KCC3 (274, 312).

Soon after discovery of electroneutral cotransport processes, much information was produced regarding potential roles of Na⁺-K⁺-2Cl^– and K⁺-Cl^– cotransporters in cell volume regulation, particularly in nonepithelial cells such as erythrocytes, as well as in epithelial salt secretion and renal reabsorption. The majority of these studies were produced before cotransporter genes were identified at the molecular level; this information will not be reviewed here. There are several excellent and extensive reviews that present comprehensive information concerning the manner in which this knowledge evolved, to which readers are referred (104, 151, 161, 164, 235, 236, 302, 348, 351, 427). In this section, what I present is a review of information generated since cloning of the cotransporter's cDNAs that is helping us to obtain better understanding of previously known roles or that has revealed new roles for each cotransporter that were either suspected or unsuspected. My focus in this section is toward understanding physiological roles of each cotransporter, not only at the cellular physiology level, but also at the levels of the physiology of different organs and systems.

A. Thiazide-Sensitive Na⁺-Cl^– Cotransporter

The thiazide-sensitive Na⁺-Cl^– cotransporter is the major NaCl transport pathway in the apical membrane of the mammalian distal convoluted tubule (DCT) (63, 109, 220, 327, 412), a nephron region that mediates reabsorption of 5–10% of glomerular filtrate. The molecular mechanism of salt reabsorption in DCT is shown in Figure 18A. In the kidney, DCT begins few cells after macula densa and is divided into "early" and "late" segments (337). The majority of studies in human, rabbit, mouse, and rat kidney agree that TSC is the major sodium reabsorption pathway along the entire DCT. While in early DCT TSC is the only Na⁺ transport pathway, during the late portion its expression overlaps with the epithelial sodium channel known as ENaC (48, 109, 247, 248, 301, 337). The sodium gradient that drives transport from lumen to interstitium is generated and maintained by very intense activity of Na⁺-K⁺-ATPase that is polarized to the basolateral membrane (91). Potassium that enters the cell through Na⁺-K⁺-ATPase is secreted at the luminal membrane by ROMK K⁺ channels (441) and by an apical K⁺-Cl^– cotransporter (14). Thus rate of Na⁺-Cl^– reabsorption determines in part the rate of K⁺ secretion.

View larger version (19K): [in this window] [in a new window]   FIG. 18. Schematic representation of Na+-coupled chloride cotransporters in transepithelial ion transport. A: ion transport pathways in distal convoluted tubule. Salt is transported in apical membrane by the Na+-Cl– cotransporter encoded by the SLC12A3 gene. B: ion transport pathways in TALH. Salt is transported in the apical membrane by the Na+-K+-2Cl– cotransporter encoded by SLC12A1 gene. C: ion transport pathways in secretory epithelial cell from any secretory epithelium such as trachea, gills, intestine, salivary gland, etc. Salt is transported from interstitial space into the cell by means of the Na+-K+-2Cl– cotransporter encoded by the SLC12A2 gene.

The fundamental role of the TSC Na⁺-Cl^– cotransporter encoded by the SLC12A3 gene in preserving extracellular fluid volume and divalent cation homeostasis has been firmly established by identification of inactivating mutations of this gene as the cause of Gitelman's disease (see sect. VIA) (221, 264, 265, 377). TSC also plays a key role in renal and cardiovascular pharmacology. As shown in Figure 18A, the apical Na⁺-Cl^– cotransporter in DCT is the major target for thiazide-type diuretics (chlorthalidone, hydrochlorothiazide, bendroflumethiazide, metolazone) (109, 136, 389). Chlorothiazide was the first effective antihypertensive agent available for clinical use, and its launch into clinical medicine in 1957 (300) was considered the greatest breakthrough in the history of drug treatment of hypertension (105, 129). Diuretics are currently used in treatment of high blood pressure, edematous states such as chronic cardiac failure, chronic renal failure, chronic liver failure, and nephrotic syndrome, as well as derangements of calcium metabolism such as renal stone disease and osteoporosis (130). Results from the recently published Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial (ALLHAT) study (401) showed that thiazides are not only effective in lowering blood pressure levels in hypertensive patients, but also help to prevent chronic cardiovascular complications. Thus the seventh report of the Joint National Committee on Prevention, Detection, and Evaluation of High Blood Pressure (57) recommends thiazides as the drug of choice for treatment of hypertension, either as a single agent or in combination with other antihypertensive drugs.

With the availability of cDNA probes, cDNA primers, and high-quality polyclonal antibodies to the majority of transporters expressed along the nephron, several techniques have been implemented to study patterns of Na⁺ transporter abundance changes under several physiological and pathophysiological circumstances (for review, see Refs. 213–215). These studies have revealed that TSC expression is highly regulated by multiple factors known to modulate renal excretion of sodium and hence arterial blood pressure. TSC is regulated by the mineralocorticoid aldosterone. Micropuncture studies in adrenalectomized rats showed several years ago that increase in sodium tubule fluid-to-plasma concentration ratio in DCT (177) was decreased to control levels by aldosterone, and microperfusion investigations showed that aldosterone increases thiazide-sensitive salt transport in DCT (411). In addition, aldosterone has been shown to increase [³H]metolazone binding in membrane fractions from renal cortex, a measure of TSC abundance (117), and by immunoblotting with specific anti-TSC antibodies, it has been demonstrated that elevated plasma aldosterone concentration is associated with an increase in TSC abundance in renal cortex when plasma aldosterone was increased by either dietary sodium restriction (262) or aldosterone infusion (210). Another study in which aldosterone was infused in dexamethasone-replaced adrenalectomized rats increased TSC abundance in renal cortex, and this effect was completely prevented by spironolactone (296). Additionally, it was demonstrated that loop and thiazide diuretic administrations are associated with increased expression of TSC (294) and that increased expression can be abrogated with spironolactone (1). All this information together suggests that aldosterone regulation of TSC protein is mediated through classical mineralocorticoid receptors. Interestingly, however, existing evidence indicates that TSC regulation by mineralocorticoids must be indirect, i.e., unrelated to TSC gene transcription, because there has been consistent failure to detect changes in TSC mRNA levels in response to dietary salt restriction (288, 436) or furosemide administration (1, 288). In this regard, a study in which TSC mRNA and protein levels were assessed simultaneously showed that increase in TSC protein induced by dietary NaCl restriction was not accompanied by detectable changes in TSC mRNA levels (263). Despite positive regulation by aldosterone, TSC is the only transport protein that is decreased during the aldosterone escape phenomenon (424). This observation suggests that one of the principal targets of pressure natriuresis is TSC; a similar conclusion was drawn by Majid and Navar based on measurements of pressure natriuresis in intact dogs (258).

Abundance of TSC protein in kidney is not regulated by aldosterone alone. TSC is a target for other hormones and regulators. For instance, TSC abundance is moderately increased by vasopressin administration (dDAVP) (100). However, when the kidney undergoes escape from vasopressin-induced water retention after development of hyponatremia, TSC abundance is more markedly increased (101). It was proposed that increase in TSC abundance in response to water retention may be associated with inappropriate secretion of antidiuretic hormone. TSC abundance is also increased under hyperinsulinemic conditions such as obesity (38), streptozotocin administration (426), or insulin infusions (99), suggesting that increased sodium reabsorption by TSC could be implicated in development of hypertension under these conditions. There are other regulators of TSC expression: gonadectomy in female rats is associated with decrease in TSC expression, which was corrected when estradiol was administered (416). Metabolic acidosis induces a decrease in TSC abundance, while metabolic alkalosis increases it (211). Potassium depletion reduces expression of TSC by a mechanism that includes a decrease in TSC mRNA levels (13). Therefore, regulation of TSC expression appears to be an important cog in overall mechanisms by which renal sodium excretion is regulated.

In winter flounder, transcripts encoding a shorter, truncated TSC isoform have been observed in several tissues including gonads, brain, skeletal muscle, intestine, heart, and eye (Table 1) (137). In mammals, however, the thiazide-sensitive Na⁺-Cl^– cotransporter is considered to be a kidney-specific gene, although several reports suggested its presence in many other tissues. Existence of a thiazide-sensitive Na⁺-Cl^– cotransporter has been suggested in brain (82), blood vessels (58), pancreas (32), peripheral blood mononuclear cells (2), bone (22), gallbladder (65), and heart (93); however, the molecular nature of a putative thiazide-sensitive mechanism in these tissues has not been properly defined. Although some studies exhibit RT-PCR amplification of a TSC cDNA fragment, the existence of the protein has not been demonstrated by Western blot or other means. The only exception seems to be bone, in which a preliminary report revealed that TSC presence in bone cells has been observed by immunohistochemistry (97). In some tissues such as brain and blood vessels, the thiazide effect is due to interaction with other proteins such as AMPA receptors (120), carbonic anhydrase (319), potassium channels (320), or nitric oxide production (61). Thus it is possible that expression of TSC is not specific for kidney, as it was initially thought (136), but confirmation of protein expression elsewhere is still pending.

B. Apical Bumetanide-Sensitive Na⁺-K⁺-2Cl^– Cotransporter

Apical bumetanide-sensitive Na⁺-K⁺-2Cl^– cotransporter BSC1/NKCC2 is the major salt transport pathway in mammalian TALH, which is in charge of reabsorbing ~15–20% of glomerular filtrate. Function of this cotransporter in TALH is not only critical for salt reabsorption, but also for production and maintenance of countercurrent multiplication mechanism, and thus in renal ability to produce urine that can be more diluted or concentrated than plasma, a functional capacity essential for survival of land mammals, including humans. In addition, TALH plays an important role in divalent cations (Ca²⁺ and Mg²⁺) and ammonium (NH₄⁺) reabsorption. Transcellular salt reabsorption by TALH promotes paracellular reabsorption of divalent cations (168), and NH₄⁺ can substitute for K⁺ in BSC1/NKCC2 cotransporter to behave as a Na⁺-NH₄⁺-2Cl^– cotransporter. As I mentioned at the beginning of this section, basic demonstrations of major roles that Na⁺-K⁺-2Cl^– cotransport plays in salt reabsorption in TALH were produced many years before identification of cotransporters at the molecular level and have been extensively reviewed in excellent manuscripts to which interested readers are referred (151, 152, 159, 167, 169, 174, 279, 348, 435). Thus here we will first review the general mechanism of salt reabsorption in TALH that will be of help in understanding the roles of the Na⁺-K⁺-2Cl^– cotransporter BSC1/NKCC2 in renal physiology, pharmacology, and pathophysiology, and then we will review new information regarding the physiology of this cotransporter in kidney that has been produced since identification of the SLC12A1 gene.

1. Molecular physiology of salt reabsorption by TALH

Molecular mechanisms of salt reabsorption by TALH are shown in Figure 18B. Na⁺-K⁺-ATPase polarized to basolateral membrane produces continuous efflux of sodium ions into interstitial space, generating a gradient for sodium transport on the apical side (155). The major pathway for sodium reabsorption in apical membrane of TALH is Na⁺-K⁺-2Cl^– cotransporter BSC1/NKCC2 (149, 153, 154, 156, 170). As shown in Figure 18B, salt reabsorption in TALH requires simultaneous operation of several transport proteins. Entrance of salt together with K⁺ occurs through the Na⁺-K⁺-2Cl^– cotransporter BSC1/NKCC2. Sodium and chloride ions leave the cell in basolateral membrane through Na⁺-K⁺-ATPase and Cl^– channels (CLC-Kb), respectively. Both Na⁺-K⁺-ATPase and CLC-Kb channels are composed of two subunits: one that carries out the transport function and another that is required for successful targeting of Na⁺-K⁺-ATPase or CLC-Kb complex to plasma membrane (139, 208, 268, 335, 371, 372, 421). These subunits in Na⁺-K⁺-ATPase or CLC-Kb are -subunit and Barttin, respectively.

Basically all potassium ions entering across the apical plasma membrane are returned to tubular lumen via an inwardly rectifying K⁺ channel known as ROMK. Potassium concentration in the glomerular ultrafiltrate (4 meq/l) is much lower than that of sodium (145 meq/l) or chloride (110 meq/l). Thus K⁺ concentration in the lumen of TALH would be rapidly reduced below the minimum required for transport, stopping the function of the Na⁺-K⁺-2Cl^– cotransporter. K⁺ recycling, however, ensures that potassium concentration within TALH lumen will be enough to allow proper function of the cotransporter. Moreover, positive voltage within TALH that resulted from K⁺ recycling together with movement of sodium and chloride to interstitial space drives reabsorption of a second cation through paracellular pathway. Because tight junctions are permeable to sodium, magnesium, and calcium, all three ions are reabsorbed at rates dependent on their luminal concentrations. Thus coordinated function between Na⁺-K⁺-2Cl^– cotransporter, apical K⁺ channels, and basolateral Cl^– channels renders TALH epithelial cells thermodynamically more efficient because two cations are reabsorbed at the expense of ATP needed to pump one (393).

The fundamental role of apical Na⁺-K⁺-2Cl^– cotransporter in salt reabsorption in TALH has been firmly established by demonstration that mutations in SLCA12A1 are associated with the development of Bartter's disease and by BSC1/NKCC2 knockout mice that reproduced a clinical picture that is similar to this illness. In this study, Takahashi et al. (397) developed a mouse with targeted disruption of SLC12A1 gene resulting in mice that were born normally but developed a clear dehydration state by day 1 of life. Then, all mice failed to thrive and by day 7 presented with severe renal failure, metabolic acidosis, hyperkalemia, high plasma renin activity, and hydronephrosis. Before the end of the second week all homozygous pups were dead. Interestingly, indomethacin treatment improved metabolic conditions of most pups by 7 days, although 90% died by 3 wk. However, the 10% that survived were able to reach adulthood without further treatment and at 10 mo exhibited the expected hypokalemia and metabolic alkalosis. In contrast to patients with Bartter's disease, survival mice developed marked hydronephrosis probably due to excessive fluid that exceeded the maximum capacity of ureters resulting in increased pressure of the renal pelvis.

Apical Na⁺-K⁺-2Cl^– cotransporter BSC1/NKCC2 also plays an important role in cardiovascular and renal pharmacology because this cotransporter is the main pharmacological target of loop diuretics (furosemide, bumetanide, ethacrynic acid, torasemide, and piretanide), the most potent natriuretic agent available for clinical use. The functional description on Figure 18B of salt reabsorption in TALH cells helps us to understand the mechanisms by which loop diuretics exert their potent effects in kidney. By blocking the Na⁺-K⁺-2Cl^– cotransporter, loop diuretics reduce salt reabsorption rate in TALH. Thus delivery of salt to the distal nephron is increased, producing significant natriuresis and diuresis. When macula densa at the end of TALH sense an increase in NaCl delivery, this will be usually compensated by decreasing glomerular filtration rate as a result of activation of the tubuloglomerular feedback mechanism (359). This compensation, however, does not occur when increased NaCl delivery is mediated by loop diuretics because the salt-sensing protein in macula densa is also BSC1/NKCC2 (presumably isoform B), which is blocked by loop diuretic (297). Increased delivery of NaCl to connecting tubule and collecting duct results in greater Na⁺ reabsorption and K⁺ secretion by principal cells, causing a greater rate of H⁺ secretion by intercalated cells of connecting tubule and outer medullary collecting duct, thus producing hypokalemia and metabolic alkalosis, a major finding of Bartter's disease (see sect. VIB). Finally, increased reabsorption of divalent cations, as a result of positive voltage in TALH lumen generated by Na⁺-K⁺-2Cl^– cotransporter, explains the hypercalciuric effect of loop diuretics, which is highly valuable during management of life-threatening hypercalcemia.

2. Regulation of the Na⁺-K⁺-2Cl^– cotransporter

Increasing net NaCl reabsorption in TALH by hormones generating cAMP via their respective G_s-coupled receptors such as vasopressin, glucagon, parathyroid hormone, -adrenergic, and calcitonin is a fundamental mechanism for regulating salt transport in this nephron segment (171, 172). Of these hormones, the most important is the antidiuretic hormone vasopressin. As demonstrated in isolated perfused tubule studies mediated by cAMP, vasopressin increases NaCl absorption by TALH (166, 171, 356) following a mechanism that appears to involve trafficking of Na⁺-K⁺-2Cl^– cotransporter, BSC1/NKCC2, from an intracellular vesicular pool to apical plasma membrane (143, 269, 325). In a recent study using a polyclonal antibody that recognizes BSC1/NKCC2 when phosphorylated at threonine residues located in the amino-terminal domain, Gimenez and Forbush (143) observed that vasopressin's effect in mouse TALH may be dependent in part on phosphorylation of BSC1/NKCC2 and that vasopressin action in TALH induces phosphorylation of Na⁺-K⁺-2Cl^– cotransporter protein that is associated with migration of cotransporter containing vesicles to apical membrane (143). In addition, as discussed in section IIIB, in mice, the stimulatory effect of vasopressin on BSC1/NKCC2 trafficking appears to be related to inhibition by cAMP of a dominant-negative effect of the 770-amino acid short isoform BSC1-S on trafficking of full-length isoform BSC1/NKCC2 (269, 325). Other hormones that generate cAMP via their respective G_s-coupled receptors stimulate concomitant increases in NaCl absorption rate, such as parathyroid hormone, calcitonin, and glucagons, presumably using similar mechanisms to those demonstrated for vasopressin (89, 103, 286). Prostaglandin E₂ has been demonstrated to have a short-term inhibitory effect on NaCl absorption in TALH (387), presumably via its ability to inhibit cAMP production in TALH cells (402). Another mediator that regulates TALH NaCl transport via effects in BSC1/NKCC2 is nitric oxide, which directly inhibits NaCl absorption in isolated perfused preparations (304).

In addition to the short-term effect of vasopressin on BSC1/NKCC2 trafficking or activity, long-term increases in vasopressin levels have been demonstrated to upregulate BSC1/NKCC2 protein expression in TALH cells (209). This action results in long-term potentiation of NaCl transport in TALH, as demonstrated by Besseghir et al. (33) in isolated perfused tubule studies in which the investigators observed that chronic in vivo administration of antidiuretic hormone to Brattleboro rats significantly increased basal voltage and chloride transport in TALH. In addition, long-term change in prostaglandin E₂ levels appears to modulate BSC1/NKCC2 expression levels in TALH because the cyclooxygenase inhibitors indomethacin or diclofenac increased BSC1/NKCC2 abundance, an effect that was reversed by misoprostol, a prostaglandin E₂ analog (122). Supporting this observation, Escalante et al. (112) previously showed in isolated rabbit mTALH cells that arachidonic acid metabolites produced a concentration-dependent inhibition of Na⁺-K⁺-2Cl^– cotransporter activity, an effect that was prevented by selective inhibition of cytochrome P-450 monooxygenases.

In addition to actions of hormones that generate cAMP in TALH, regulatory mediators using other signal mechanisms also modulate BSC1/NKCC2 expression in TALH. Glucocorticoids increase BSC1/NKCC2 mRNA and protein expression by a mechanism that requires vasopressin, while aldosterone has no effect on BSC1/NKCC2 expression levels (18). By stimulating cGMP production, nitric oxide increases BSC1/NKCC2 expression, as observed by Turban et al. (405) as a marked decrease in this cotransporter abundance in response to inhibition of nitric oxide synthases by N^G-nitro-L-arginine methyl ester (L-NAME). In addition, while angiotensin II infusion was found to increase BSC1/NKCC2 abundance in TALH (225), absence of AT1a receptors in mice (44) or blockade of angiotensin II AT1 receptors by candesartan (36) did not produce opposite effects, suggesting that the angiotensin II effect on BSC1/NKCC2 expression is indirect and related to local changes in nitric oxide or PGE₂ levels. Finally, expression of BSC1/NKCC2 is also regulated by acid-base status. Chronic metabolic acidosis has been shown to enhance expression of BSC1/NKCC2 mRNA and protein in medullary TALH (17) by glucocorticoid-dependent and -independent mechanisms (18). In this regard, it has been recently found that what metabolic acidosis does is increase the stability of BSC1/NKCC2 mRNA, without affecting SLC12A1 transcription rate (206). Under physiological conditions, most of the ammonium produced in the proximal tubule is reabsorbed in TALH to be later secreted in medullary collecting ducts and excreted into urine (146, 216). Thus, during acidosis in which production of ammonium by proximal tubule is increased, enhancing of BSC1/NKCC2 expression arises as a compensatory mechanism to increase ammonium reabsorption.

C. Basolateral Bumetanide-Sensitive Na⁺-K⁺-2Cl^– Cotransporter

After the discovery of an electroneutral Na⁺-K⁺-2Cl^– cotransport mechanism by Geck et al. in Ehrlich cells (138), it was soon established that this salt-transport pathway was present in several epithelial and nonepithelial cells. As previously mentioned, at cellular physiology level a major role of the Na⁺-K⁺-2Cl^– cotransporter in epithelial and nonepithelial cells is in cell-volume regulation processes, mainly as one of the membrane transporters activated during cell shrinkage, as part of regulatory volume increase mechanisms (230). As shown in Figure 18C, in epithelial cells the Na⁺-K⁺-2Cl^– cotransporter is polarized to basolateral membrane and plays a critical role in providing cells with Cl^– that are secreted through the apical membrane. The driving force for Na⁺ transport maintained by Na⁺-K⁺-ATPase activity allows BSC2/NKCC1 to transport Na⁺, K⁺, and Cl^– from interstitium into the cell. The majority of the Na⁺ and K⁺ recycle into interstitial fluid by Na⁺-K⁺-ATPase and conductive pathways, respectively, while Cl^– are secreted into the lumen by several conductive pathways, one of the most important being the CFTR (364). The existence of Na⁺-K⁺-2Cl^– cotransporter in secretory epithelium from several organs including respiratory epithelium, parotid gland, intestine, colon, eye, ear, mammary gland, and shark rectal gland, among others, was originally demonstrated by functional analysis and later by immunolocalization using specific antibodies. The sole exception is in the choroid plexus in the CNS in which BSC2/NKCC1 expression is polarized to the apical membrane, together with Na⁺-K⁺-ATPase (438). Most of this information has been recently reviewed. Interested readers are advised to consult these excellent manuscripts (164, 351). What I wish to review here are the physiological roles that have emerged for BSC2/NKCC1 at the organ or system level due in part to the observations done in knockout mice. As shown in Figure 19, several interesting phenotypes have arisen in mice harboring disrupted mutations on the SLC12A2 gene that include gastrointestinal, cardiovascular, auditory, salivary, testicular, and growth retardation phenotypes.

View larger version (38K): [in this window] [in a new window]   FIG. 19. Several phenotypes result from targeted disruption of the SLC12A2 gene. Total absence of BSC2/NKCC1 is associated with azoospermia [modified from Pace et al. (306)]; growth retardation, deafness, and imbalance (78, 123); decreased pain perception (229, 394); impaired saliva production [modified from Evans et al. (114)]; decrease in blood pressure levels (123, 277), and gastrointestinal secretory problems ending in death due to cecum and colonic blockade (123, 157). Although BSC2/NKCC1 knockout mice exhibit a clear decrease in Cl– influx in respiratory epithelium, the absence of a respiratory phenotype appears to be due to compensation by other anion transporters (158).

BSC2/NKCC1 knockout mice are deaf due to a sensorineural defect. These mice exhibit the characteristic shaker/waltzer phenotype apparent in continuous circling and head movements accompanied by frequent loss of balance. This behavior is known to be due to inner-ear dysfunction. The existing mouse model of shaker-with-syndactylism is a radiation-induced mutant mouse exhibiting deafness and fusion of digits. This colony has produced the fused-phalanges mouse sy^FP that exhibits various degrees of digit fusion without deafness, and the no-syndactylism sy^NS that is deaf without syndactylism. Using a positional cloning approach, Dixon et al. (90) recently demonstrated that SLC12A2 is the gene defective in sy^NS mice. Thus three different disruptions in the SLC12A2 gene produced similar inner ear phenotype. BSC2/NKCC1-null mice exhibit histological evidence of dysfunction of epithelial secretion in labyrinth such as collapse of endolymphatic cavity and a Reissner's membrane lying above on the top of stria vascularis, rather than in its normal position between scala media and scala vestibules; in addition, it is known that BSC2/NKCC1 is expressed in the basolateral membrane of stria vascularis and vestibular cells (78). Thus it is likely that BSC2/NKCC1 plays an important role in providing epithelial cells with sufficient K⁺, which is secreted in the apical side into cochlear chamber (353). Absence of the Na⁺-K⁺-2Cl^– cotransporter in basolateral membrane is then associated with significant reduction of K⁺ secretion into endolymph. Supporting this conclusion, a similar sensorineural-deafness phenotype is present in knockout mice of a subunit of the K⁺ channel (minK) present in apical membrane of stria vascularis, through which K⁺ are secreted (417). Therefore, two distinct disruptions of K⁺ handling by stria vascularis cells result in profound deafness.

BSC2/NKCC1-null mice exhibit growth retardation, and ~30% spontaneously died between days 18 and 26 of life, due to cecum bleeding and severe blockade of colon. A similar situation occurs in CFTR knockout mice (379), suggesting that the basolateral Na⁺-K⁺-2Cl^– cotransporter plays indeed a very important role in providing epithelial cells with ions secreted in the apical membrane. In this regard, cAMP-stimulated short-circuit current (I_sc) in jejunum and cecum of BSC2/NKCC1 knockout mice was ~50% of that shown to be present in normal mice. These observations, however, have not been consistently observed because increased mortality due to intestinal problems was not present in BSC2/NKCC1-null mice done by other groups (78, 306). The difference appears to be adaptability of intestinal epithelium, which in the absence of Cl^– secretion exhibits an increase in HCO₃^– secretion (157). Finally, within the gastrointestinal system, as revealed by Evans et al. (114) BSC2/NKCC1 knockout mice also exhibited severe salivation impairment (Fig. 19). In contrast to normal mice, null mice observed a complete absence of BSC2/NKCC1 expression in basolateral membrane of parotid acinal cells, which was accompanied by reduction of ~60% in the amount of saliva secreted in response to muscarinic agonist carbachol, with a total loss of bumetanide-sensitive Na⁺-K⁺-2Cl^– influx. The remaining saliva production is due to compensatory upregulation of AE2 Cl^–/HCO₃^– exchanger expression. A similar situation occurs with ion transport in airway epithelia. Normal mice exhibit robust bumetanide-sensitive ion transport in basolateral membrane of tracheal epithelium, which is absent in BSC2/NKCC1 null mice. However, spontaneous airway diseases are not developed in knockout mice. Experiments performed with ion substitutions and several drugs suggest that absence of Cl^– secretion by the Na⁺-K⁺-2Cl^– cotransporter in null mice is well compensated with HCO₃^– secretion (158).

Conflicting results were observed between two groups regarding blood pressure effects of BSC2/NKCC1 targeted disruption. Pace et al. (306) reported that arterial blood pressure measured in conscious mice using a tail-cuff system revealed no significant difference between BSC2/NKCC1 wild-type and null mice. In addition, no difference in renal function and vasopressin response was observed; however, a decrease in blood pressure has been recorded by Flagella et al. (123). This group first reported that blood pressure levels measured by means of femoral artery catheter on anesthetized mice revealed a significant decrease in blood pressure in both heterozygous ^+/– (77 ± 4.1 mmHg) and homozygous ^–/– (68 ± 2.8 mmHg) mice, when compared with normal mice (92 ± 4 mmHg). The blood pressure in this mouse model was reanalyzed in awake animals by means of tail-cuff system to assess systolic blood pressure, and a significant reduction was again observed in BSC2/NKCC1-null mice (114 ± 2.2 mmHg in null vs. 131 ± 2.5 mmHg in wild-type) (277). No changes in aldosterone and electrolytes in blood suggested that low blood pressure is not due to a decrease in extracellular fluid volume. Cardiac function was normal. A small but significant reduction in contractility of portal veins was observed, suggesting that hypotension could be due to a reduction in vascular tone; however, no further studies to verify this hypothesis have been performed.

Male BSC2/NKCC1-null mice are infertile, whereas females exhibit successful pregnancies without reproductory impairment. Histological analysis revealed normal reproductive organs in females. In contrast, complete infertility of males was associated with deficit in spermatocyte production accompanied by architectural disruption of testis and epididymis (306). These observations suggest that the absence of a basolateral Na⁺-K⁺-2Cl^– cotransporter in seminiferous tubules has a similar consequence to that seen in inner ear, in which impairment in K⁺ secretion results in blockade of spermatocyte maturation. In addition, low levels of testosterone and luteinizing hormones in null mice suggested a deficit in hypothalamus/pituitary axis (79).

The Na⁺-K⁺-2Cl^– cotransporter encoded by the SLC12A2 gene appears to have very important functional roles in primary sensory neurons of vertebrates by making possible presynaptic inhibition and nociception (10, 51, 229, 394). Functional expression of NKCC1 in these nerve cells was first shown by Alvarez-Leefmans et al. (8). Using double-barreled Cl^– selective microelectrodes, these investigators measured simultaneously transmembrane potential (E_m) and intracellular free Cl^– concentration ([Cl^–]_i) in the cell bodies of frog sensory neurons (i.e., dorsal root ganglion cells). They showed that sensory neurons have a higher [Cl^–]_i than that predicted for a passive distribution, that the intracellular Cl^– accumulation in these cells is sensitive to bumetanide and dependent on the presence of extracellular Na⁺, K⁺, and Cl^–. Their measurements directly showed that bumetanide-sensitive Cl^– movements across the membrane occurred without concurrent changes in E_m and therefore concluded that the mechanism that generates and maintains the outwardly directed Cl^– gradient across membrane was an electroneutral Na⁺-K⁺-2Cl^– cotransport system. They were the first to suggest that by keeping [Cl^–]_i above electrochemical equilibrium, the cotransporter function explained why GABA produces depolarization of primary sensory neurons, a critical factor in producing presynaptic inhibition between afferent terminals in the spinal cord (350). The prevailing idea regarding this issue is that GABA released from interneurons depolarizes primary afferent fibers via axo-axonic synapses. The depolarization inactivates Na⁺ channels sufficiently to decrease or block action potential invasion into primary afferent terminals, thereby inhibiting transmitter release and selectively channeling sensory information into spinal cord. GABA depolarizations result from an efflux of Cl^– through GABA_A-gated anion channels. The key element for generation of the outward Cl^– current in terminals of primary afferents is equilibrium potential for chloride (E_Cl), which is kept at a more positive value than E_m by BSC2/NKCC1. These observations suggest that intracellular Cl^– accumulation by the BSC2/NKCC1 is a key component of GABA depolarization and modulation of sensory input to the spinal cord.

Later on, using specific antibodies against BSC2/NKCC1, the presence of this cotransporter was confirmed in the plasma membrane of dorsal root ganglion neurons from mice (326), and those from frogs, cats, and rats, including their afferent axons (9). GABA-induced currents in dorsal neurons of wild-type and BSC2/NKCC1-null mice were studied by Sung et al. (394) using gramicidin-perforated patch and whole cell recordings. In neurons from wild-type animals, intracellular Cl^– accumulation was suggested because GABA evoked inward currents at resting membrane potentials. In contrast, in neurons from BSC2/NKCC1-null animals, no current was observed at resting membrane potential, and GABA evoked reduced depolarizing or even hyperpolarizing currents. In this same study, it was shown that BSC2/NKCC1-null animals exhibited an impaired nocioceptive phenotype. Specifically, experiments with BSC2/NKCC1-null mice demonstrated impaired pain perception in the hot plate test, suggesting that Na⁺-K⁺-2Cl^– cotransporter is involved in pain perception. More recently, Laird et al. (229) examined the role of the cotransporter in generation of touch-evoked pain (allodynia). BSC2/NKCC1-null animals showed an increase in tail flick latencies and a reduction in pain behavior induced by intradermal capsaicin compared with heterozygous and wild-type animals. The BSC2/NKCC1-null animals showed a reduction in stroking hyperalgesia (touch-evoked pain) compared with wild-type and heterozygous mice. As BSC2/NKCC1 is responsible for the generation of presynaptic inhibition between afferent terminals in the spinal cord, these results supported the notion that presynaptic interactions between low- and high-threshold afferents can underlie allodynia (51).

Expression of NKCC1 is developmentally regulated in postnatal rat brain (59, 328). Consistent with this finding, in embryonic neurons, GABA has a widespread depolarizing action (30) that seems crucial in promoting Ca²⁺ influx, influencing important developmental events such as neuronal proliferation, differentiation, and migration and neurite extension and targeting. Again, depolarizing action of GABA is likely to result from an efflux of chloride through GABA_A-gated anion channels, the driving force for Cl^– efflux being generated and maintained by BSC2/NKCC1 (443).

D. K⁺-Cl^– Cotransporter 1

The K⁺-Cl^– cotransporter KCC1 is a ubiquitously expressed protein. As discussed in section IIB, KCC1 was the first isoform of KCC cotransporters to be identified at the molecular level (142). In this study it was shown that KCC1 mRNA transcripts are present in all tested tissues including brain, colon, heart, kidney, liver, lung, spleen, stomach, placenta, muscle, and pancreas. The expression in erythrocytes was later demonstrated by Pellegrino et al. (316). Therefore, KCC1 is a ubiquitously expressed isoform of K⁺-Cl^– cotransporters that appears to play a fundamental role in cell volume regulation. In this regard, it has been shown that KCC1 is activated by cell swelling (142, 275). The majority of K⁺-Cl^– cotransporter activity in red blood cells has been attributed to KCC1, with some contribution of KCC3 (238). It has been speculated that K⁺-Cl^– efflux in red blood cells is an important mechanism for cell size reduction with maturation and that activity of the K⁺-Cl^– cotransporter is increased in hemoglobinopathies such as sickle cell disease (235).

Since four unexpected genes encoding K⁺-Cl^– cotransporters were identified following in silico cloning strategies, little is still known on the physiological roles of each K⁺-Cl^– cotransporter gene at the organ or system levels. Moreover, simultaneous expression of at least two or three KCCs in several organs is common. Absence of KCC1 knockout mice in world literature precludes clarification of KCC1 physiological roles at the organ level. As previously mentioned, KCC1 is widely expressed in cells and tissues, but its presence could be related to either its fundamental role in cell volume regulation or a certain role in physiological aspects of a particular tissue. For instance, KCC1 is expressed in the basolateral membrane of exocrine glands such as salivary, parotid, and pancreatic glands (349), but the physiological role of such expression remains to be clarified. The fact that KCC1 is expressed in basolateral membrane of colonic epithelium and K⁺ (but not Na⁺) depletion is associated with a significant increase in KCC1 mRNA and protein levels suggest that KCC1 in colon is involved into transepithelial transport of K⁺ (355).

All four K⁺-Cl^– cotransporters are expressed in the CNS (29, 204, 313, 315) in which regulation of intracellular Cl^– concentration by electroneutral cotransporter plays an important role in defining type and magnitude of response to certain neurotransmitters. Specific roles of KCC1 in CNS, however, have not been defined. By in situ hybridization it was shown that expression of KCC1 mRNA is low and widespread, with higher expression within olfactory bulb, hippocampus, cerebellum, and choroid plexus (59, 202). However, the physiological role of KCC1 remains elusive.

E. K⁺-Cl^– Cotransporter 2

Initial cloning of KCC2 cDNA demonstrated that expression of this K⁺-Cl^– cotransporter is restricted to the CNS (313). Following in situ hybridization and immunohistochemical studies it was shown that KCC2 expression is prominent in neurons throughout the CNS. KCC2 expression is high in pyramidal neurons of the hippocampus, granular cells, and Purkinje neurons of the cerebellum, retinal neurons, and neuronal groups throughout the brain stem (202). The neuronal restriction for KCC2 expression is probably due to negative transcriptional regulation in all other cells, since SLC12A5 genes possess a single neuronal-restrictive silencing element (NRSE) that is located just 3' of exon 1. This restrictive element is present in both human and mouse genes (205, 380).

In conjunction with NKCC1, KCC2 expression in neurons is extremely important in defining the type and magnitude of response to certain neurotransmitters such as glycine and GABA during development and maturation. In central neurons, binding of GABA to GABA_A receptors in adult animals opens ligand-gated Cl^– channels, allowing inward movement of Cl^– into cells with the consequent hyperpolarization. Thus in adult animals, GABA has a hyperpolarizing inhibitory effect on neuronal excitability. In contrast, binding of GABA to GABA_A receptors during early neuronal development produces an outward Cl^– current, resulting in membrane depolarization. The latter is in all similar to that already discussed for adult sensory neurons (see above). Several lines of evidence support the hypothesis that, in addition to NKCC1, [Cl^–]_i is regulated during ontogeny by KCC2, thereby explaining the perinatal differences in GABA response. KCC2 expression levels are very low at birth, with a marked increase during the first week of postnatal development (59, 250). Reduction of KCC2 expression in pyramidal cells from rat hippocampus using antisense oligonucleotides markedly shifted the reversal potential of GABA response (346). This is likely to be explained by releasing the action of KCC2 on NKCC1. The latter now works without the opposing thermodynamic force of KCC2. Depolarizing response to GABA early in development triggers Ca²⁺ influx via both voltage-dependent and NMDA-gated channels (131, 240), with significant neurodevelopmental consequences (47, 160, 212). In this regard, while GABA induced expression of KCC2 protein, thus limiting its brief window of neurotrophic effect (240), brain-derived neurotrophic factor (BDNF) and neurotrophin-4 decrease KCC2 expression, thus amplifying neuronal excitability in conditions associated with upregulation of BDNF (345).

As discussed in section IIIE, KCC2 is the K⁺-Cl^– cotransporter with the higher affinity for both cotransported ions (310, 380), which is appropriate to the emerging role of KCC2 as a buffer of both external K⁺ and internal Cl^– that was suggested by Payne (310). Thus, if extracellular K⁺ is increased during neuronal activity to values as high as 10–12 mM, a range wherein KCC2 is highly active, driving force for net K⁺-Cl^– cotransport will switch from efflux to influx. This reversibility of K⁺-Cl^– cotransport has been verified experimentally (75, 193, 201).

The role of KCC2 in CNS physiology is so important that complete ablation of KCC2 expression in null mice results in early neonatal death that is basically secondary to apneic respiratory failure (184). Consistent with a role of KCC2 in switching GABA response from excitatory to inhibitory, it was observed in the same study that GABA and glycine were inhibitory in wild-type neurons but excitatory in KCC2-null mice neurons. KCC2 silencing by itself cannot explain the depolarizing shift of E_Cl. The latter requires active accumulation of Cl^–, which is likely to act without the opposing force of KCC2. Development of a KCC2-null mice exhibiting modest residual expression of KCC2 provided Woo et al. (437) with knockout mice that survive some time after birth; this allowed the investigators to study effects of dramatic, but not absolute, reduction in KCC2 expression. The homozygous null mice exhibited continuous generalized seizures, because these mice are very easily triggered by modest stimuli. Constant epilepsy resulted in neuronal damage with postnatal death at ~17 days of age. Interestingly, heterozygous animals exhibited no particular phenotype but possessed a lower threshold for epileptic seizures induced by pentylenetetrazole. That reduced KCC2 expression resulted in animals with intractable epilepsy is another evidence for the role of this cotransporter in regulation of neuronal excitability and suggests a role for KCC2 in human epilepsy.

As previously discussed, coordinated expression of electroneutral cation chloride cotransporters during development in certain neuronal groups is a primary event defining the type of response to neurotransmitters that interact with gated anion channels. The transition in the response to GABA from excitatory in prenatal period to inhibitory in postnatal life appears to be explained by intraneuronal Cl^– concentrations that are observed in developing versus in mature neurons (77). Developing neurons exhibit an [Cl^–]_i that is maintained above its electrochemical potential equilibrium, whereas mature neurons exhibit [Cl^–]_i below its potential equilibrium. As Figure 20 shows, change from excitatory in prenatal life to inhibitory in postnatal life is associated with BSC2/NKCC1 downregulation together with KCC2 upregulation after birth (59, 243, 278, 328). In early development, BSC2/NKCC1 appears to be the primary transporter responsible for high intraneuronal Cl^– concentration. Expression of this cotransporter, however, is downregulated after birth. In contrast, expression of KCC2 in neuronal groups like hipoccampal, cortical, and retinal neurons is absent during early development, but present after birth and during adult life (346, 420); thus it is currently believed that switching of intraneuronal Cl^– concentration in neurons from early development to postnatal life is due to changes in the type of electroneutral cotransporter that is expressed.

View larger version (32K): [in this window] [in a new window]   FIG. 20. Schematic representation of relationship between maturation of neurons, type of response to GABA, and expression of electroneutral cotransporters. Right and left diagrams depict BSC2/NKCC1 and KCC2 cotransporters expression and a representative whole cell voltage-clamp analysis showing the type of responses to GABA. The left diagram shows prenatal situation in which KCC2 expression is minimal and BSC2/NKCC1 expression is robust. The response to GABA is excitatory. In contrast, the right panel shows the postnatal situation. BSC2/NKCC1 expression is reduced, whereas KCC2 expression is increased, resulting in a response to GABA that is inhibitory. [Modified from Delpire (77) and Mercado et al. (274).]

KCC3 cDNA was independently identified by three groups in 1999 (178, 178, 292, 331, 331). Since then, study of this K⁺-Cl^– cotransporter has begun to reveal interesting roles in cell growth and in CNS, inner ear, and vascular physiology. The role in cell growth will be discussed in section VIE.

KCC3 protein is expressed in most brain areas, including hypothalamus, cerebellum, brain stem, cerebral cortex, and white matter (315). It is also abundant in spinal cord and is expressed at very low levels in dorsal root ganglia. A possible role of KCC3 protein in cerebrospinal fluid K⁺ reabsorption is suggested by its presence at the base of the choroid plexus. The neuronal groups expressing KCC3 are the large hippocampal neurons, cortical pyramidal neurons, and cerebellar Purkinje neurons, as well as in white matter tracts throughout the brain. Ontogeny of KCC3 correlates with development of myelin, because expression is low at birth and increases during postnatal development, similar to the pattern observed for myelin binding protein (29, 315).

Mutations in KCC3 are the cause of a rare neurological illness known as Anderman's disease, also known as hereditary motor and sensory neuropathy associated with agenesis of the corpus callosum (HMSN/ACC, OMIM 218000). This is an interesting disease because some of the clinical manifestations are due to developmental problems (in neurons), while others are due to neurodegeneration (particularly in white matter). In addition, the clinical picture includes deficiencies of both central and peripheral nervous system, as well as in cognitive activity. KCC3 central role in CNS development and function has been corroborated by reproduction of most of the neurological problems seen in Anderman's disease in a KCC3 knockout mice model (42, 183). Mice homozygous for disruption of KCC3 were found to exhibit severe locomotor deficit, peripheral neuropathy, and sensorimotor gating deficit. Mice did not have agenesis or dysgenesis of the corpus callosum. Although these findings collectively reveal critical roles for KCC3 in development and maintenance of nervous system, it remains unknown how loss of KCC3-mediated K⁺-Cl^– cotransport causes various features of HMSN/ACC, and why absence of KCC3 cannot be compensated by other KCCs also present in neurons. Reduction in cell growth or cell volume regulation observed in KCC3-null mice neurons (42) could be implicated in progressive neurodegeneration.

In addition to BSC2/NKCC1 (see above) and KCC4 (see below), KCC3 have an important role in development and function of inner ear (42). In normal conditions, KCC3 is expressed in supporting cells of inner and outer hair cells, in epithelial cells of the organ of Corti, and in type I and III fibrocytes of stria vascularis. In contrast to observations on BSC2/NKCC1 (79) and KCC4 (41) knockout mice, deafness in KCC3 is not present at birth and develops during the first year of life, associated with the degenerative process of the cochlea.

Arterial pressure is elevated in KCC3 knockout mice (42). This variable was not assessed in knockout animals from Howard et al. (183) and does not appears to be a major clinical problem in patients with HMSN/ACC (96); however, the average age of death in Anderman's patients is 24 years, which could be an early stage for hypertension to be present. Boettger et al. (42) by means of chronic implanted catheters observed that arterial pressure in wild-type mice at 3–5 mo of age was 100 ± 2 mmHg, whereas in KCC3 knockout mice it was 118 ± 2 mmHg (P < 0.01). The mechanism is not known but could be related to expression and activity of KCC3 in vascular smooth muscle cells (178) or kidney (42, 293). In this regard, interesting studies have been produced revealing a role of nitric oxide and vasodilators in regulating KCC3 activity in vascular smooth muscle cells. First, it was observed in low potassium (LK) sheep red blood cells that activity of K⁺-Cl^– cotransporter was increased by nitric oxide (3). Because nitric oxide is a potent vasodilator, investigators hypothesized that activation of KCCs in vascular smooth muscle by nitric oxide could be implicated in vasodilation. Thus Adragna et al. (4) assessed the effect of several vasodilatory drugs such as hydralazine, sodium nitroprusside, isosorbide mononitrate, and pentaerythritol on K⁺-Cl^– cotransporter activity in LK red blood cells and vascular smooth muscle cells in primary cultures. All vasodilators activated K⁺-Cl^– cotransporter in both types of cells, and a specific inhibitor of protein kinase GKT-5823 abolished the increase in K⁺-Cl^– cotransporter activity induced by sodium nitroprusside. In addition, inhibition of K⁺-Cl^– cotransporter decreased vasodilatory response magnitude to hydralazine; thus it was suggested that the K⁺-Cl^– cotransporter was activated by nitric oxide through a cGMP pathway and that this activation was involved in response to vasodilators.

Molecular analysis of vascular smooth muscle cells revealed that among K⁺-Cl^– cotransporters, KCC1 and KCC3 are expressed, whereas KCC2 and KCC4 are not present. KCC1 abundance is higher than KCC3 by a 2:1 relation (87). mRNA expression of both cotransporters was analyzed under experimental conditions designed to activate protein kinase G (PKG). With the use of semi-quantitative PCR strategy, it was observed that KCC3 mRNA expression was upregulated by the cell membrane-permeable 8-bromo-cGMP. This effect was abrogated by the PKG inhibitor KT5823, indicating that activation of PKG is involved and was not affected by concomitant incubation with actinomycin D, suggesting that increased transcription of the SLC12A6 gene is not involved (87). Similar observations were obtained for KCC1 mRNA (84). In this study it was observed that the nitric oxide donor sodium nitroprusside and the nitric oxide-independent soluble guanylyl cyclase activator YC-1 induced upregulation of KCC1 mRNA expression. The soluble guanylyl cyclase inhibitor LY83583 abrogates positive effects of both sodium nitroprusside and YC-1, indicating that activation of guanylyl cyclase is involved. In addition, 8-bromo-cGMP also increased KCC1 mRNA expression by a mechanism that was partially abrogated by KT5823. Thus mRNA expression of both KCC1 and KCC3 is enhanced by activating the nitric oxide/cGMP pathway. A further study in primary cultures of rat vascular smooth muscle cells revealed that fast nitric oxide releasers NONOates such as NOC-5 and NOC-9, but not the slow releaser NOC-18, are able to upregulate KCC1 and KCC3 mRNA levels. NOC-5 and NOC-9 effects were prevented by the soluble guanylyl cyclase inhibitor LY83583, indicating again that activation required the classical pathway of nitric oxide-soluble guanylyl cyclase-cGMP-PKG (86). Finally, the most recent work related to this issue revealed that sodium nitroprusside, YC-1, and 8-bromo-cGMP increased mRNA levels of both KCC3a and KCC3b isoforms, with more apparent effect in KCC3b (85). All these data showing that powerful vasodilators induce activation of KCC3 cotransporter suggest that KCC3 activity could be associated with vasodilatation. If this turns out to be true, then derangement in KCC3 activity could be associated with decreased vasorelaxation, thus increasing peripheral vascular resistance. For this reason, the development of high blood pressure in KCC3-null mice (42) is an important observation that supports a role of KCC3 in arterial pressure regulation.

G. K⁺-Cl^– Cotransporter 4

KCC4 is the K⁺-Cl^– cotransporter isoform for which less information is available regarding its role in global physiology. This isoform was identified by Mount et al. (292), and its tissue distribution is basically ubiquitous, although in certain tissues expression is less apparent than that of KCC1. Northern blot analysis of KCC4 in nervous tissues suggested that no transcripts are present in the CNS; however, recent studies using RT-PCR and Western blot using specific antibodies have shown that KCC4 is present in both the central and peripheral nervous system, with higher expression in peripheral nerves (trigeminal, sciatic) and spinal cord than in whole brain (29, 204). Within the brain, expression of KCC4 is higher in the brain stem, followed by midbrain, with minimal to nonexpression in cerebral cortex and hippocampus. Thus there is a gradient of KCC4 expression in the nervous system that goes forebrain < midbrain < spinal cord < peripheral nerves. In addition, evidence was shown by Karadsheh et al. (204) that KCC4 is present not only in neurons, but also in oligodendrocytes and in the apical membrane of choroid plexus epithelial cells, suggesting a role for this K⁺-Cl^– cotransporter isoform in K⁺ reabsorption. Finally, KCC4 expression is downregulated after birth (243).

Specific role of KCC4 in CNS physiology has not been elucidated. KCC4 knockout animals were normal at birth and exhibit no apparent malfunction of the nervous system. At an early age (14 days), hearing in KCC4-null mice is normal; however, it quickly deteriorates over the next 10 days, at the end of which the mice are completely deaf (41). This is associated with total loss of outer hair cells of basal cochlea by 21 days of age. Because immunohistochemical analysis of wild-type mice demonstrated that within the inner ear KCC4 is expressed in Deiters' cells, which have been suggested to transport K⁺ from outer hair cells (and thus endolymph) to adjacent epithelial cells, thus recycling K⁺ via stria vascularis, it was postulated that absence of K⁺ transport in Deiters' cells results in reduction of K⁺ absorption by outer hair cells and thus accumulation in endolymph.

KCC4 plays an interesting role in acid-base metabolism. KCC4-null mice develop renal tubular acidosis. Urinary pH in knockout mice was observed to be significantly higher than in wild-type animals (7.3 ± 0.1 vs. 6.4 ± 0.1, P < 0.01) and thus null animals develop compensated metabolic acidosis (41). Intrarenal distribution analysis of KCC4 by means of polyclonal antibodies revealed abundant expression in basolateral membrane of several nephron segments, including proximal tubule, DCT, and CD. In this later part of the nephron, expression is heavy in -intercalated cells that are in charge of proton secretion (41, 293, 414). Thus it has been postulated that KCC4 activity in intercalated cells could be required for basolateral Cl^– extraction, which in turn is necessary to keep the AE1 Cl^–/HCO₃^– exchanger fully active. In this regard, Boettger et al. (41) demonstrated high intracellular Cl^– concentration in KCC4 knockout mice -intercalated cells. In addition, as previously discussed in section IIIG, K⁺-Cl^– cotransporters are able to transport ammonium instead of K⁺. Finally, expression of KCC4 in basolateral membrane of TALH could account for the proposed basolateral K⁺-Cl^– cotransport activity described by Greger et al. (155). Although KCC4 is expressed in many other tissues, physiological roles for its presence have not been reported.

	VI. PATHOPHYSIOLOGICAL ROLES

Top Previous Next References

 
Given the multiple physiological roles for electroneutral cation-coupled chloride cotransporters in the kidney, CNS, and other organs, it was expected that variations in function and/or expression of these genes played a role in human pathophysiology. To date, inactivating mutations of three members in this family have been shown to be linked with development of inherited conditions such as Gitelman's, Bartter's, and Anderman's diseases. In addition, changes in functional regulation of TSC in Gordon's disease have been suggested to be a key mechanism in the pathophysiology of this inherited disease in which genetic primary defect occurs in other genes. Finally, the known physiological role of cotransporters, together with their involvement in inherited diseases and observations performed in knockout mice with targeted disruption of each electroneutral cotransporter, indicate that members of this family are also potentially involved in some of the most important polygenic diseases, such as hypertension, epilepsy, cancer, and osteoporosis. In this section, we review each of the inherited diseases due to primary defects in members of cation-coupled chloride cotransporters and the evidence for their involvement in polygenic diseases.

A. Gitelman's Disease

In 1966, Gitelman, Graham, and Welt (145) reported the metabolic study of three patients seen at the North Carolina Memorial Hospital (United States) featuring a syndrome characterized by hypokalemia, hypomagnesemia, and metabolic alkalosis who exhibited clear renal impairment for conservation of potassium and magnesium. Patients were not hypertensive and had normal urinary excretion of aldosterone, excluding primary aldosteronism. Two of the three patients were sisters, and their parents were distantly related through a common male ancestor. Since then, this rare inherited condition is known as Gitelman's disease and features an autosomal recessive pattern of inheritance. The majority of affected patients began with the clinical picture in the second or third decade of life, clinically evidenced by hypokalemic metabolic alkalosis, accompanied with arterial hypotension, hypocalciuria, and hypomagnesemia. The clinical picture resembles that observed in patients intoxicated with thiazide-type diuretics and is similar to that present in Bartter's disease; thus these two conditions are the major differential diagnosis. In 1992, Bettinelli et al. (34) studied a cohort of 34 pediatric patients with inherited hypokalemic metabolic alkalosis among whom Bartter's disease was present in 18 and Gitelman's disease was present in 16. Because children with Bartter's disease exhibited hypercalciuria, while those with Gitelman's disease exhibited hypocalciuria, the investigators concluded that both diseases are easily distinguishable on the basis of urinary calcium excretion.

Due to resemblance of Gitelman's disease with clinical and metabolic picture of chronic thiazide-type diuretic intoxication, TSC became a strong candidate for the cause of the disease. Thus, after molecular identification of TSC from fish and mammalian sources (136, 137), complete linkage between Gitelman's disease and the locus for TSC in human chromosome 16 was observed by several groups (242, 264, 329, 377). This information strongly suggested that inactivating mutations of SLC12A3 were the causative agent of Gitelman's disease. Later, a phenotype resembling Gitelman's disease was obtained in mice by targeted disruption of TSC gene (363), and heterologous expression in X. laevis oocytes of mouse or human TSC cRNA containing some point mutations reported in Gitleman's kindreds revealed that mutant TSC proteins are nonfunctional (72, 221). Thus it is currently accepted that Gitelman's disease is due to inactivating mutations of TSC.

At present, ~65 independent kindreds with Gitelman's disease have been studied, and the majority of reported mutations have been deposited in the Human Gene Mutation Database at the Institute of Medical Genetics in Cardiff, United Kingdom (http://archive.uwcm.ac.uk/uwcm/mg/hgmd0.html). There are ~100 different mutations spread throughout the SLC12A3 gene, from the amino- to the carboxy-terminal domain of TSC, without preference for a particular location along the protein (55, 64, 67, 241, 245, 259, 264, 271, 281, 307, 339, 377, 395, 396, 398, 442, 449). Figure 21 illustrates the proposed TSC secondary structure and location of the majority of reported mutations. Up to 77% result from nucleotide substitutions producing missense or nonsense mutations or frame shifts that terminate in truncated proteins. In general, these substitutions occur in amino acid residues that are conserved among TSC from human, rat, mouse, rabbit, and flounder. Small deletions are responsible for 10.4% of mutations, whereas nucleotide substitutions affecting either donor or acceptor splice sites are responsible for 7.2%. The remainder is due to micro-lesions, such as small insertions or indels.

View larger version (47K): [in this window] [in a new window]   FIG. 21. Mutations in human thiazide-sensitive Na+-Cl– cotransporter TSC reported in patients with Gitelman's disease. Each circle represents one amino acid residue. All circles in red represent mutations. Mutations numbered 1–9 are the following: 1, W174; 2, S178L; 3, Y180K; 4, R261H; 5, P349L; 6, A464T; 7, F536L; 8, L542P; and 9, A569V. There is a blue circle every 25 residues. Every 100 residues are numbered. The black circle in transmembrane segment 4 depicts the position of a single nucleotide polymorphism G264A.

As shown in Figure 22, there are at least five potential mechanisms by which mutations reduce or abolish transporter activity. A mutation could 1) impair protein synthesis, 2) impair protein processing, 3) impair insertion of an otherwise functional protein into plasma membrane, 4) impair functional properties of the cotransporter, and 5) accelerate protein removal or degradation. Although not studied, it is highly likely that mutations that introduce stop codons or produce frame shifts and those in which splicing is abolished resulting in nonsense proteins belong to group 1 (Fig. 22), in which synthesis of the complete protein is impaired (375, 395, 408). Using heterologous expression system in X. laevis oocytes, Kunchaparty et al. (221) analyzed functional consequences of several missense mutations reported along TSC protein in kindreds with Gitelman's disease; they observed that proteins were synthesized but were not properly glycosylated and not expressed at the plasma membrane. These results indicated that the majority of Gitelman's missense mutations pertain to the second possibility (Fig. 22) because they impair cotransporter function by interfering with protein processing. These conclusions are supported by results from Hoover et al. (181) indicating that glycosylation of TSC is required for proper folding and trafficking of cotransporter to plasma membrane. Later, functional properties and surface expression analysis performed by De Jong et al. (72) and Sabath et al. (352) revealed that Gitelman's missense mutations resulting in partial functional proteins belong to the third possibility in Figure 22, in which missense mutation results in a cotransporter with apparently normal processing and normal functional and kinetic properties, but in which insertion into plasma membrane is partially impaired. Interestingly, as reviewed later, missense mutations of other members of the electroneutral cotransporter family, such as the Na⁺-K⁺-2Cl^– cotransporter in type I Bartter's disease (384) and the KCC3 K⁺-Cl^– cotransporter in Anderman's disease (183), behave as the fourth possibility in Figure 22, because mutated proteins are normally produced and inserted into plasma membrane, implying a defect in functional properties or intrinsic activity of the cotransporter.

View larger version (25K): [in this window] [in a new window]   FIG. 22. Molecular mechanisms explaining decreased activity of electroneutral cotransporters in inherited syndromes. [Modified from Sabath et al. (352).]

View larger version (12K): [in this window] [in a new window]   FIG. 23. Relationship between age- and sex-adjusted diastolic blood pressure (left) and urinary sodium excretion (right) in a large family with Gitelman's disease including 26 patients with Gitelman's disease (–/–), 113 heterozygous subjects (–/+), and 60 normal subjects (+/+). *Groups –/+ and +/+ are different from –/– group (P = 0.002). **Groups –/– and –/+ are different from +/+ group (P = 0.06). [Modified from Cruz et al. (68).]

Bartter's disease was originally described in 1962 by Bartter et al. (23) as a salt-losing nephropathy accompanied by polyuria, hypokalemic metabolic alkalosis, and hypertrophy of the juxtaglomerular complex. It is now known that Bartter's disease represents a group of autosomal-recessive disorders with common underlying pathophysiology due to absence or severe reduction in TALH ability for salt reabsorption. The majority of patients with this disease are seen in consanguineous families. This is a more severe nephropathy than Gitelman's disease, because the clinical picture is usually apparent in the first year of life or even in antenatal period as excessive accumulation of amniotic fluid (polyhydramnios). The characteristic clinical picture includes a salt-wasting state with low blood pressure, metabolic alkalosis with hypokalemia, hypereninemia, and secondary aldosteronism (366). The majority of patients also exhibit hypercalciuria and some develop nephrocalcinosis. Elevated levels of prostaglandin E₂ in blood and urine are common, particularly in patients with antenatal disease, and it is known that treatment with cyclooxygenase inhibitors such as indomethacin improves child development and facilitates salt and water-loss management. The fact that clinical and biochemical response to indomethacin and the specific cyclooxygenase-2 inhibitor Refecoxib are similar strongly supports that increased prostaglandin E₂ is due to chronic activation of cyclooxygenase-2 activity in the macula densa (338).